SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


triose phosphate isomerase, glycolytic/ gluconeogenic enzyme
26.88 kDa
protein length
253 aa Sequence Blast
gene length
762 bp Sequence Blast
enzyme in glycolysis/ gluconeogenesis
triosephosphate isomerase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|Glycolysis]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|Gluconeogenesis]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    3,479,405 3,480,166

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|23420519]
  • poor growth [pubmed|28189581]
  • poorly transformable [pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • D-glyceraldehyde 3-phosphate --> dihydroxyacetone phosphate (according to UniProt)
  • Protein family

  • triosephosphate isomerase family (single member,according to UniProt)
  • Modification

  • phosphorylation on Ser-213 [Pubmed|17218307]
  • Effectors of protein activity

  • inhibited by 2-phosphoglycolate (in ''B. stearothermophilus'') [Pubmed|8580851]
  • Structure

  • [PDB|1BTM] (complex with 2-phosphoglycolic acid, Geobacillus stearothermophilus), complex with 2-phosphpoglycolic acid, ''Geobacillus stearothermophilus'' [ NCBI]
  • [SW|Localization]

  • cytoplasm (homogeneously distributed throughout the cell) [Pubmed|24825009,16479537]
  • Additional information

  • extensive information on the structure and enzymatic properties of Tpi can be found at [ Proteopedia]
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11489127], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR]: repression, [Pubmed|11489127], in [regulon|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR regulon]
  • regulation

  • expression induced by glycolytic intermediates ([protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR]) [protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR] [Pubmed|11489127]
  • the mRNA is processed between [gene|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR] and [gene|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    view in new tab

    Biological materials


  • GP700 (cat), available in [SW|Jörg Stülke]'s lab, [Pubmed|23420519]
  • BKK33920 ([gene|0B5E910DC94463E34ABD393E3A8F20191E4A38B2|tpi]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTTCCACTTCCTTAT, downstream forward: _UP4_GTTCAATTATTGGAGGAAGG
  • Expression vectors

  • pGP394 (N-terminal His-tag, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • pGP89 (N-terminal Strep-tag, for [SW|SPINE], expression in B. subtilis), available in [SW|Jörg Stülke]'s lab, [pubmed|19193632]
  • pGP1511 (expression in ''B. subtilis'', in [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab, [pubmed|19193632]
  • References

  • 12850135,11489127,17505547,8021172,17218307,8580851,19193632,21821766,23420519,15378759,24825009,28189581