SubtiBank SubtiBank
yqcI
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yqcI

unknown
locus
BSU_25820
pI
5.03
mw
29.95 kDa
protein length
254 aa Sequence Blast
gene length
765 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,658,006 2,658,770

    The protein

    Protein family

  • DcsA family (with [protein|CBEC4D299232FC5FCB57211525404CBD42D5AF68|YcgG], according to UniProt)
  • Paralogous protein(s)

  • [protein|CBEC4D299232FC5FCB57211525404CBD42D5AF68|YcgG]
  • Biological materials

    Mutant

  • BKE25820 ([gene|0B5A1E73710CF6A158925CC51E170BA7BEF3B495|yqcI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATAAATCCACCTCCGAAG, downstream forward: _UP4_TAAATTGTTTAAAACCTTAT
  • BKK25820 ([gene|0B5A1E73710CF6A158925CC51E170BA7BEF3B495|yqcI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATAAATCCACCTCCGAAG, downstream forward: _UP4_TAAATTGTTTAAAACCTTAT