SubtiBank SubtiBank
yqcI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqcI

unknown
locus
BSU_25820
pI
5.03
mw
29.95 kDa
protein length
254 aa Sequence Blast
gene length
765 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,658,006 2,658,770

    The protein

    Protein family

  • DcsA family (with [protein|CBEC4D299232FC5FCB57211525404CBD42D5AF68|YcgG], according to UniProt)
  • Paralogous protein(s)

  • [protein|CBEC4D299232FC5FCB57211525404CBD42D5AF68|YcgG]
  • Biological materials

    Mutant

  • BKE25820 ([gene|0B5A1E73710CF6A158925CC51E170BA7BEF3B495|yqcI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATAAATCCACCTCCGAAG, downstream forward: _UP4_TAAATTGTTTAAAACCTTAT
  • BKK25820 ([gene|0B5A1E73710CF6A158925CC51E170BA7BEF3B495|yqcI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATAAATCCACCTCCGAAG, downstream forward: _UP4_TAAATTGTTTAAAACCTTAT