SubtiBank SubtiBank
stoA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

stoA

thiol-disulfide oxidoreductase, with thioredoxin-like domain, required for the synthesis of the endospore peptidoglycan cortex
locus
BSU_13840
pI
5.30
mw
18.66 kDa
protein length
165 aa Sequence Blast
gene length
498 bp Sequence Blast
function
spore cortex formation, maturation of [protein|search|SpoVD ]in the forespore outer membrane
product
thiol-disulfide oxidoreductase
essential
no
synonyms
spoIVH,ykvV

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,450,638 1,451,135

    The protein

    Catalyzed reaction/ biological activity

  • reduction of intramolecular disulfide bonds in [protein|38FD9805815BBDDD83789F0F402C0FB221B65FF4|SpoVD] in the forespore outer membrane [Pubmed|19919673]
  • Protein family

  • [SW|Thioredoxin family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|50BBC8AB77B99B9FE5B8A8FE906D39DFEA4ED652|YneN], [protein|F7D869F77E2275110737EF658C58FA1BF742D73F|ResA]
  • [SW|Domains]

  • [SW|Thioredoxin domain] (aa 27-165) (according to UniProt)
  • Structure

  • [PDB|3ERW] [pubmed|19144642]
  • [SW|Localization]

  • forespore envelope [Pubmed|19919673]
  • Expression and Regulation

    Operons

    genes
    [gene|34A5CD28A3DBCB10B4E1C82E50143FA73B553919|ykvU]-[gene|0B299F9459023306FA91298A6162A09E4A87C3B2|stoA]
    description
    [Pubmed|15292147]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|12662922], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15292147], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed during sporulation ([protein|search|SigE], [protein|search|SigG]) [Pubmed|12662922,15292147]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|stoA]' and '[protein|search|zosA]' [PubMed|20525796]
  • view in new tab

    genes
    [gene|0B299F9459023306FA91298A6162A09E4A87C3B2|stoA]
    description
    [Pubmed|15292147]

    regulation

  • expressed during sporulation ([protein|search|SigE], [protein|search|SigG]) [Pubmed|12662922,15292147]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|stoA]' and '[protein|search|zosA]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B328 (ykvV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1327 NBRP B. subtilis, Japan]
  • 1S130 ( ''stoA''::''cat''), [Pubmed|15342593], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S130&Search=1S130 BGSC]
  • 1S131 ( ''stoA''::''tet''), [Pubmed|15342593], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S131&Search=1S131 BGSC]
  • BKE13840 ([gene|0B299F9459023306FA91298A6162A09E4A87C3B2|stoA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGAATCTTCCTTTCATG, downstream forward: _UP4_TAGCTGAGAGCATAGACTCT
  • BKK13840 ([gene|0B299F9459023306FA91298A6162A09E4A87C3B2|stoA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGAATCTTCCTTTCATG, downstream forward: _UP4_TAGCTGAGAGCATAGACTCT
  • labs

  • [SW|Lars Hederstedt], University of Lund, Sweden [http://www.cob.lu.se/microbiology/heme.html Homepage]
  • References

    Reviews

  • 19919674
  • Original Publications

  • 12662922,15292147,15342593,19144642,19919673,20525796,28383125