SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


thiol-disulfide oxidoreductase, with thioredoxin-like domain, required for the synthesis of the endospore peptidoglycan cortex
18.66 kDa
protein length
165 aa Sequence Blast
gene length
498 bp Sequence Blast
spore cortex formation, maturation of [protein|search|SpoVD ]in the forespore outer membrane
thiol-disulfide oxidoreductase

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,450,638 1,451,135

    The protein

    Catalyzed reaction/ biological activity

  • reduction of intramolecular disulfide bonds in [protein|38FD9805815BBDDD83789F0F402C0FB221B65FF4|SpoVD] in the forespore outer membrane [Pubmed|19919673]
  • Protein family

  • [SW|Thioredoxin family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|50BBC8AB77B99B9FE5B8A8FE906D39DFEA4ED652|YneN], [protein|F7D869F77E2275110737EF658C58FA1BF742D73F|ResA]
  • [SW|Domains]

  • [SW|Thioredoxin domain] (aa 27-165) (according to UniProt)
  • Structure

  • [PDB|3ERW] [pubmed|19144642]
  • [SW|Localization]

  • forespore envelope [Pubmed|19919673]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|12662922], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15292147], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed during sporulation ([protein|search|SigE], [protein|search|SigG]) [Pubmed|12662922,15292147]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|stoA]' and '[protein|search|zosA]' [PubMed|20525796]
  • view in new tab



  • expressed during sporulation ([protein|search|SigE], [protein|search|SigG]) [Pubmed|12662922,15292147]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|stoA]' and '[protein|search|zosA]' [PubMed|20525796]
  • view in new tab

    Biological materials


  • MGNA-B328 (ykvV::erm), available at the [ NBRP B. subtilis, Japan]
  • 1S130 ( ''stoA''::''cat''), [Pubmed|15342593], available at [ BGSC]
  • 1S131 ( ''stoA''::''tet''), [Pubmed|15342593], available at [ BGSC]
  • BKE13840 ([gene|0B299F9459023306FA91298A6162A09E4A87C3B2|stoA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGAATCTTCCTTTCATG, downstream forward: _UP4_TAGCTGAGAGCATAGACTCT
  • BKK13840 ([gene|0B299F9459023306FA91298A6162A09E4A87C3B2|stoA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGAATCTTCCTTTCATG, downstream forward: _UP4_TAGCTGAGAGCATAGACTCT
  • labs

  • [SW|Lars Hederstedt], University of Lund, Sweden [ Homepage]
  • References


  • 19919674
  • Original Publications

  • 12662922,15292147,15342593,19144642,19919673,20525796,28383125