SubtiBank SubtiBank
coiA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

coiA

protein involved in establishment of DNA transport in competence
locus
BSU_11530
pI
9.97
mw
43.53 kDa
protein length
373 aa Sequence Blast
gene length
1122 bp Sequence Blast
function
genetic competence
product
unknown
essential
no
synonyms
yjbF

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • Gene

    Coordinates
    1,229,915 1,231,036

    Expression and Regulation

    Operons

    genes
    [gene|0B1F5A160ADFF3EA904122A7E43E13C5828B31BE|coiA]-[gene|3F0700B5E3B944116D2F9A150F7AB4263A3E41EE|pepF]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|0B1F5A160ADFF3EA904122A7E43E13C5828B31BE|coiA]
    description
    (according to [http://dbtbs.hgc.jp/COG/prom/yjbF.html DBTBS]) null
    view in new tab

    Biological materials

    Mutant

  • MGNA-B153 (yjbF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1152 NBRP B. subtilis, Japan]
  • BKE11530 ([gene|0B1F5A160ADFF3EA904122A7E43E13C5828B31BE|coiA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGCCGTCTTCAGTCA, downstream forward: _UP4_TGAGTTTGTCTTATTTGGCT
  • BKK11530 ([gene|0B1F5A160ADFF3EA904122A7E43E13C5828B31BE|coiA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGCCGTCTTCAGTCA, downstream forward: _UP4_TGAGTTTGTCTTATTTGGCT
  • References

  • 17630974