SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


N-acetyl-muramic acid-6P etherase (cleaves lactate from N-acetylmuramic acid)
32.55 kDa
protein length
304 aa Sequence Blast
gene length
915 bp Sequence Blast
cell wall turnover
N-acetyl-muramic acid-6P etherase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW|Utilization of cell wall components]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of amino sugars]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW|Utilization of amino sugars]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    192,051 192,965

    Phenotypes of a mutant

  • strongly reduced viability during prolonged incubation in stationary phase [Pubmed|27729505]
  • The protein

    Catalyzed reaction/ biological activity

  • H2O + N-acetyl-D-muramate 6-phosphate --> (R)-lactate + N-acetyl-D-glucosamine 6-phosphate (according to UniProt)
  • Protein family

  • GCKR-like family (single member, according to UniProt)
  • Modification

  • phosphorylation on Ser-2 [Pubmed|17218307]
  • Structure

  • [PDB|4S12] (from Yersinia enterocolitica, 51% identity)
  • Expression and Regulation



    regulatory mechanism

  • [protein|125872506C400CB6B3DAEA8B5130B064DFBA4494|MurR]: repression, [pubmed|30038046], in [regulon|125872506C400CB6B3DAEA8B5130B064DFBA4494|MurR regulon]
  • regulation

  • expressed in late exponential and early stationary phase [Pubmed|20400549]
  • view in new tab

    Biological materials


  • MGNA-B952 (ybbI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE01700 ([gene|0B1F43F43A4DC1574A153DBFBAA5D0A1855F9B61|murQ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGGATGCCCCCTGTTT, downstream forward: _UP4_CATCCATGATAAGGAGAGAA
  • BKK01700 ([gene|0B1F43F43A4DC1574A153DBFBAA5D0A1855F9B61|murQ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGGATGCCCCCTGTTT, downstream forward: _UP4_CATCCATGATAAGGAGAGAA
  • References

  • 17218307,20400549,22383849,27729505,30038046