SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


[SW|ABC transporter] (membrane protein) for rhamnose oligosaccharides
33.32 kDa
protein length
296 aa Sequence Blast
gene length
891 bp Sequence Blast
uptake of rhamnose oligosaccharides
rhamnose oligosaccharide [SW|ABC transporter]

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of carbon sources]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of pectin]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    763,875 764,765

    The protein

    Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • [SW|MalFG subfamily] (according to UniProt)
  • [SW|Domains]

  • [SW|ABC transmembrane type-1 domain] (aa 91-282) (according to UniProt)
  • Structure

  • [PDB|4TQU] (from Sphingomonas sp., 25% identity) [pubmed|26235029]
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Biological materials


  • MGNA-A949 (yesQ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE06990 ([gene|0B11FACEB5E96D166AC1EA0E32C68FCDAF8327E4|rhiG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGGCTGGTTGACCGGCTCCA, downstream forward: _UP4_TTAAAATAAAAAGGAGTGTT
  • BKK06990 ([gene|0B11FACEB5E96D166AC1EA0E32C68FCDAF8327E4|rhiG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGGCTGGTTGACCGGCTCCA, downstream forward: _UP4_TTAAAATAAAAAGGAGTGTT
  • References

  • 10092453,17449691,24391637,26235029