SubtiBank SubtiBank
rhiG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rhiG

[SW|ABC transporter] (membrane protein) for rhamnose oligosaccharides
locus
BSU06990
pI
9.52
mw
33.32 kDa
protein length
296 aa Sequence Blast
gene length
891 bp Sequence Blast
function
uptake of rhamnose oligosaccharides
product
rhamnose oligosaccharide [SW|ABC transporter]
essential
no
synonyms
yesQ

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.1|Uptake of carbon sources]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.26|Utilization of pectin]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    763,875 764,765

    The protein

    Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • Structure

  • [PDB|4TQU] (from Sphingomonas sp., 25% identity) [pubmed|26235029]
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Biological materials

    Mutant

  • MGNA-A949 (yesQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/949 NBRP B. subtilis, Japan]
  • BKE06990 ([gene|0B11FACEB5E96D166AC1EA0E32C68FCDAF8327E4|rhiG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGGCTGGTTGACCGGCTCCA, downstream forward: _UP4_TTAAAATAAAAAGGAGTGTT
  • BKK06990 ([gene|0B11FACEB5E96D166AC1EA0E32C68FCDAF8327E4|rhiG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGGCTGGTTGACCGGCTCCA, downstream forward: _UP4_TTAAAATAAAAAGGAGTGTT
  • References

  • 10092453,17449691,24391637,26235029