SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


lipid II flippase
59.30 kDa
protein length
544 aa Sequence Blast
gene length
1635 bp Sequence Blast
export of lipid II
lipid II flippase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Biosynthesis of peptidoglycan]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW|Biosynthesis of peptidoglycan]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,073,531 3,075,165

    Phenotypes of a mutant

  • an ''[gene|12DB5AF311932991B66716BBCD08DA2C45B43BB9|amj] [gene|0AFFB4B715CCE6B1C53BBB7F890EFB3126CB466E|murJ]'' double mutant is not viable [Pubmed|25918422]
  • a ''[gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM] [gene|0AFFB4B715CCE6B1C53BBB7F890EFB3126CB466E|murJ]'' double mutant is not viable (due to the lack of both lipid II flippases) [Pubmed|25918422]
  • mutants lacking [protein|0AFFB4B715CCE6B1C53BBB7F890EFB3126CB466E|MurJ] produce long cells and chains of cells [Pubmed|19648239]
  • The protein

    Protein family

  • [SW|Polysaccharide synthase family] (according to UniProt)
  • [SW|MOP exporter family]
  • Paralogous protein(s)

  • [protein|34A5CD28A3DBCB10B4E1C82E50143FA73B553919|YkvU], [protein|9633C40190B7D0EA264270FD44567C61A012AD15|SpoVB], [protein|D6B1837075ECBEE1FEAC704DDB6795336092897F|YabM]
  • Structure

  • [PDB|5T77] (from ''Thermosipho africanus'', 20% identity) [Pubmed|28024149]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A012 (ytgP::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE30050 ([gene|0AFFB4B715CCE6B1C53BBB7F890EFB3126CB466E|murJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCTTCATCACCATT, downstream forward: _UP4_TGATGAACTAGATATGATGA
  • BKK30050 ([gene|0AFFB4B715CCE6B1C53BBB7F890EFB3126CB466E|murJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCTTCATCACCATT, downstream forward: _UP4_TGATGAACTAGATATGATGA
  • References


  • 26679002,28975672
  • Original Publications

  • 19648239,19666716,25918422,28024149,29558128,29443967