SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


lipid II flippase
59.30 kDa
protein length
544 aa Sequence Blast
gene length
1635 bp Sequence Blast
export of lipid II
lipid II flippase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Biosynthesis of peptidoglycan]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW|Biosynthesis of peptidoglycan]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,073,531 3,075,165

    Phenotypes of a mutant

  • an ''[gene|12DB5AF311932991B66716BBCD08DA2C45B43BB9|amj] [gene|0AFFB4B715CCE6B1C53BBB7F890EFB3126CB466E|murJ]'' double mutant is not viable [Pubmed|25918422]
  • a ''[gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM] [gene|0AFFB4B715CCE6B1C53BBB7F890EFB3126CB466E|murJ]'' double mutant is not viable (due to the lack of both lipid II flippases) [Pubmed|25918422]
  • mutants lacking [protein|0AFFB4B715CCE6B1C53BBB7F890EFB3126CB466E|MurJ] produce long cells and chains of cells [Pubmed|19648239]
  • The protein

    Protein family

  • [SW|Polysaccharide synthase family] (according to UniProt)
  • [SW|MOP exporter family]
  • Paralogous protein(s)

  • [protein|34A5CD28A3DBCB10B4E1C82E50143FA73B553919|YkvU], [protein|9633C40190B7D0EA264270FD44567C61A012AD15|SpoVB], [protein|D6B1837075ECBEE1FEAC704DDB6795336092897F|YabM]
  • Structure

  • [PDB|5T77] (from ''Thermosipho africanus'', 20% identity) [Pubmed|28024149]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A012 (ytgP::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE30050 ([gene|0AFFB4B715CCE6B1C53BBB7F890EFB3126CB466E|murJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCTTCATCACCATT, downstream forward: _UP4_TGATGAACTAGATATGATGA
  • BKK30050 ([gene|0AFFB4B715CCE6B1C53BBB7F890EFB3126CB466E|murJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCTTCATCACCATT, downstream forward: _UP4_TGATGAACTAGATATGATGA
  • References


  • 26679002,28975672
  • Original Publications

  • 19648239,19666716,25918422,28024149,29558128,29443967