SubtiBank SubtiBank
murJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

murJ

lipid II flippase
locus
BSU_30050
pI
10.09
mw
59.30 kDa
protein length
544 aa Sequence Blast
gene length
1635 bp Sequence Blast
function
export of lipid II
product
lipid II flippase
essential
no
synonyms
ytgP

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.1|Biosynthesis of peptidoglycan]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.1|Biosynthesis of peptidoglycan]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,073,531 3,075,165

    Phenotypes of a mutant

  • an ''[gene|12DB5AF311932991B66716BBCD08DA2C45B43BB9|amj] [gene|0AFFB4B715CCE6B1C53BBB7F890EFB3126CB466E|murJ]'' double mutant is not viable [Pubmed|25918422]
  • a ''[gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM] [gene|0AFFB4B715CCE6B1C53BBB7F890EFB3126CB466E|murJ]'' double mutant is not viable (due to the lack of both lipid II flippases) [Pubmed|25918422]
  • mutants lacking [protein|0AFFB4B715CCE6B1C53BBB7F890EFB3126CB466E|MurJ] produce long cells and chains of cells [Pubmed|19648239]
  • The protein

    Protein family

  • [SW|Polysaccharide synthase family] (according to UniProt)
  • [SW|MOP exporter family]
  • Paralogous protein(s)

  • [protein|34A5CD28A3DBCB10B4E1C82E50143FA73B553919|YkvU], [protein|9633C40190B7D0EA264270FD44567C61A012AD15|SpoVB], [protein|D6B1837075ECBEE1FEAC704DDB6795336092897F|YabM]
  • Structure

  • [PDB|5T77] (from ''Thermosipho africanus'', 20% identity) [Pubmed|28024149]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|0AFFB4B715CCE6B1C53BBB7F890EFB3126CB466E|murJ]-[gene|69052B24B577ABA4B20E610F679154DC97EFD8DE|ytzG]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A012 (ytgP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/12 NBRP B. subtilis, Japan]
  • BKE30050 ([gene|0AFFB4B715CCE6B1C53BBB7F890EFB3126CB466E|murJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCTTCATCACCATT, downstream forward: _UP4_TGATGAACTAGATATGATGA
  • BKK30050 ([gene|0AFFB4B715CCE6B1C53BBB7F890EFB3126CB466E|murJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCTTCATCACCATT, downstream forward: _UP4_TGATGAACTAGATATGATGA
  • References

    Reviews

  • 26679002,28975672
  • Original Publications

  • 19648239,19666716,25918422,28024149,29558128,29443967