SubtiBank SubtiBank
glpX
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

glpX

class II fructose-1,6-bisphosphatase, gluconeogenesis
locus
BSU_37090
pI
5.07
mw
33.80 kDa
protein length
321 aa Sequence Blast
gene length
966 bp Sequence Blast
function
gluconeogenesis
product
class II fructose-1,6-bisphosphatase
essential
no
ec
3.1.3.11
synonyms
ywjI

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.2|Gluconeogenesis]
  • Gene

    Coordinates
    3,805,090 3,806,055

    The protein

    Catalyzed reaction/ biological activity

  • β-D-fructose 1,6-bisphosphate + H2O --> β-D-fructose 6-phosphate + phosphate (according to UniProt)
  • Protein family

  • FBPase class 2 family (single member, according to UniProt)
  • Kinetic information

  • K(M) for FBP: 20 M [Pubmed|19270101]
  • Structure

  • [PDB|3D1R] (from ''E. coli'', 49% identity, 68% similarity)[Pubmed|19073594]
  • Expression and Regulation

    Operons

    genes
    [gene|523B01B5E7141C7DFC28CE67EB92580F49C20844|murAB]-[gene|0AFCE5C602B073B29DB15DB3CDD153E05E3D02BD|glpX]
    description
    [Pubmed|19270101]

    regulation

  • constitutive [Pubmed|19270101]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B658 (ywjI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1657 NBRP B. subtilis, Japan]
  • BKE37090 ([gene|0AFCE5C602B073B29DB15DB3CDD153E05E3D02BD|glpX]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCAACACGATCTCCTC, downstream forward: _UP4_TAACAAACAGAAAAAGCGGG
  • BKK37090 ([gene|0AFCE5C602B073B29DB15DB3CDD153E05E3D02BD|glpX]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCAACACGATCTCCTC, downstream forward: _UP4_TAACAAACAGAAAAAGCGGG
  • References

  • 19270101,19073594