SubtiBank SubtiBank
glpX
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

glpX

class II fructose-1,6-bisphosphatase, gluconeogenesis
locus
BSU_37090
pI
5.07
mw
33.80 kDa
protein length
321 aa Sequence Blast
gene length
966 bp Sequence Blast
function
gluconeogenesis
product
class II fructose-1,6-bisphosphatase
essential
no
ec
3.1.3.11
synonyms
ywjI

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.2|Gluconeogenesis]
  • Gene

    Coordinates
    3,805,090 3,806,055

    The protein

    Catalyzed reaction/ biological activity

  • β-D-fructose 1,6-bisphosphate + H2O --> β-D-fructose 6-phosphate + phosphate (according to UniProt)
  • Protein family

  • FBPase class 2 family (single member, according to UniProt)
  • Kinetic information

  • K(M) for FBP: 20 M [Pubmed|19270101]
  • Structure

  • [PDB|3D1R] (from ''E. coli'', 49% identity, 68% similarity)[Pubmed|19073594]
  • Expression and Regulation

    Operons

    genes
    [gene|523B01B5E7141C7DFC28CE67EB92580F49C20844|murAB]-[gene|0AFCE5C602B073B29DB15DB3CDD153E05E3D02BD|glpX]
    description
    [Pubmed|19270101]

    regulation

  • constitutive [Pubmed|19270101]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B658 (ywjI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1657 NBRP B. subtilis, Japan]
  • BKE37090 ([gene|0AFCE5C602B073B29DB15DB3CDD153E05E3D02BD|glpX]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCAACACGATCTCCTC, downstream forward: _UP4_TAACAAACAGAAAAAGCGGG
  • BKK37090 ([gene|0AFCE5C602B073B29DB15DB3CDD153E05E3D02BD|glpX]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCAACACGATCTCCTC, downstream forward: _UP4_TAACAAACAGAAAAAGCGGG
  • References

  • 19270101,19073594