SubtiBank SubtiBank
ypbG
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ypbG

unknown
locus
BSU_22980
pI
6.61
mw
28.41 kDa
protein length
259 aa Sequence Blast
gene length
780 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    2,404,249 2,405,028

    The protein

    Structure

  • [PDB|2WDC] (from Thermus thermophilus, corresponds to aa 122 ... 228 of YpbG, 27% identity) [pubmed|19535341]
  • Expression and Regulation

    Operons

    genes
    [gene|0AF09652E1D13C82A4F296EA99132491FF55F45D|ypbG]
    description
    [Pubmed|17434969]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|17434969], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A396 (ypbG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/396 NBRP B. subtilis, Japan]
  • BKE22980 ([gene|0AF09652E1D13C82A4F296EA99132491FF55F45D|ypbG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAACTCTCCATTCT, downstream forward: _UP4_TAACTTCTAAAAAGCAAAAA
  • BKK22980 ([gene|0AF09652E1D13C82A4F296EA99132491FF55F45D|ypbG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAACTCTCCATTCT, downstream forward: _UP4_TAACTTCTAAAAAGCAAAAA
  • References

  • 17434969,19535341