SubtiBank SubtiBank
yqiI
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yqiI

secreted N-acetylmuramoyl-L-alanine amidase
locus
BSU_24190
pI
4.29
mw
22.09 kDa
protein length
206 aa Sequence Blast
gene length
621 bp Sequence Blast
function
cell wall metabolism
product
peptidoglycan hydrolase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.3|Utilization of cell wall components]
  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.6|Cell wall degradation/ turnover/ Additional genes]
  • Gene

    Coordinates
    2,514,979 2,515,599

    The protein

    Catalyzed reaction/ biological activity

  • cell wall hydrolysis [Pubmed|22843846]
  • Protein family

  • [SW|N-acetylmuramoyl-L-alanine amidase 3 family] (according to UniProt)
  • [SW|Domains]

  • contains an amidase_3 domain (like [protein|5CDF32B0E78F01C696364555E3F0BC8DF2AA2089|CwlC], [protein|B09FB626274B81F00A4FB42D188E089095343182|CwlD], [protein|6A21293823151C6980BF52B31A4B249A8440F2E1|LytC], [protein|BE34A9CE3AF99E8880FC24E34E5D79A1627260AE|YrvJ])
  • [SW|MurNAc-LAA domain] (aa 32-201) (according to UniProt)
  • Structure

  • [PDB|4RN7] (from Clostridium difficile, 39% identity)
  • [SW|Localization]

  • secreted (with N-terminal signal sequence for SEC-mediated transport) [Pubmed|22843846]
  • Expression and Regulation

    Operons

    genes
    [gene|AEA18C431FE13FC34671E673DC6733B200E342A8|yqiH]-[gene|0AD75864794E597AA9160969ADE6FE0C7ED07B9F|yqiI]-[gene|AF37A0E08AAAA9159DD1F0183A61713EF582E830|yqiK]
    description
    [Pubmed|22843846,22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22843846], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • only expressed under conditions of high osmolarity [Pubmed|32419322,22843846]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C372 (yqiI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2370 NBRP B. subtilis, Japan]
  • BKE24190 ([gene|0AD75864794E597AA9160969ADE6FE0C7ED07B9F|yqiI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCAACTTACTCCCTC, downstream forward: _UP4_TAGATTGATACAGCCTTAAT
  • BKK24190 ([gene|0AD75864794E597AA9160969ADE6FE0C7ED07B9F|yqiI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCAACTTACTCCCTC, downstream forward: _UP4_TAGATTGATACAGCCTTAAT
  • References

  • 22383849,22843846,32419322