SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to transcription factor ([SW|AraC family])
32.29 kDa
protein length
275 aa Sequence Blast
gene length
828 bp Sequence Blast

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factor/ other/ based on similarity]
  • Gene

    242,834 243,661

    The protein

    Protein family

  • [SW|AraC family]
  • [SW|Domains]

  • [SW|HTH araC/xylS-type domain] (aa 171-268) (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B970 (ybfI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE02220 ([gene|0AD208CFDA10F7BED022583C8448EFA7E37B9E33|ybfI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGGATGCCTCCTGTCGG, downstream forward: _UP4_ATTTTTGAAAAGGAGCTTCA
  • BKK02220 ([gene|0AD208CFDA10F7BED022583C8448EFA7E37B9E33|ybfI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGGATGCCTCCTGTCGG, downstream forward: _UP4_ATTTTTGAAAAGGAGCTTCA
  • References

  • 23504016