SubtiBank SubtiBank
ybfI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ybfI

similar to transcription factor ([SW|AraC family])
locus
BSU_02220
pI
6.10
mw
32.29 kDa
protein length
275 aa Sequence Blast
gene length
828 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    242,834 243,661

    The protein

    Protein family

  • [SW|AraC family]
  • [SW|Domains]

  • [SW|HTH araC/xylS-type domain] (aa 171-268) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|0AD208CFDA10F7BED022583C8448EFA7E37B9E33|ybfI]-[gene|5084B6223B9F261E9FE1C65CD3F5FE20AF7E5ECE|ybfH]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B970 (ybfI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1969 NBRP B. subtilis, Japan]
  • BKE02220 ([gene|0AD208CFDA10F7BED022583C8448EFA7E37B9E33|ybfI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGGATGCCTCCTGTCGG, downstream forward: _UP4_ATTTTTGAAAAGGAGCTTCA
  • BKK02220 ([gene|0AD208CFDA10F7BED022583C8448EFA7E37B9E33|ybfI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGGATGCCTCCTGTCGG, downstream forward: _UP4_ATTTTTGAAAAGGAGCTTCA
  • References

  • 23504016