SubtiBank SubtiBank
yxkO [2019-07-16 08:18:14]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yxkO [2019-07-16 08:18:14]

ADP/ATP-dependent NAD(P)H-hydrate dehydratase, general stress protein, survival of ethanol stress
29.72 kDa
protein length
276 aa Sequence Blast
gene length
831 bp Sequence Blast
survival of ethanol stress, repair of hydrated NAD(P)H
ADP/ATP-dependent NAD(P)H-hydrate dehydratase

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • Gene

    3,972,448 3,973,278

    The protein


  • [PDB|1KYH] [pubmed|12457846]
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials


  • MGNA-B749 (yxkO::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE38720 ([gene|0A9C77804C09CD5E7D1D5D274E01B5B14920A1A9|yxkO]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTATCCCTCCTCTGC, downstream forward: _UP4_TTTGAATGATAAAAAAGCTG
  • BKK38720 ([gene|0A9C77804C09CD5E7D1D5D274E01B5B14920A1A9|yxkO]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTATCCCTCCTCTGC, downstream forward: _UP4_TTTGAATGATAAAAAAGCTG
  • References

  • 15805528,10746760,12457846,22940582,25393291,17702456