SubtiBank SubtiBank
yxkO [2018-03-18 11:42:22]
Don't miss! The Virtual International Conference on Bacillus will take place from June 8 to June 12! Website

yxkO [2018-03-18 11:42:22]

ADP/ATP-dependent NAD(P)H-hydrate dehydratase, general stress protein, survival of ethanol stress
locus
BSU38720
pI
5.49
mw
29.72 kDa
protein length
276 aa Sequence Blast
gene length
828 bp Sequence Blast
function
survival of ethanol stress
product
ADP/ATP-dependent NAD(P)H-hydrate dehydratase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • Gene

    Coordinates
    3,972,448 → 3,973,278

    The protein

    Structure

  • [PDB|1KYH]
  • Expression and Regulation

    Operons

    genes
    [gene|0A9C77804C09CD5E7D1D5D274E01B5B14920A1A9|yxkO]
    description
    [Pubmed|10746760]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B749 (yxkO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1748 NBRP B. subtilis, Japan]
  • BKE38720 (Δ[gene|0A9C77804C09CD5E7D1D5D274E01B5B14920A1A9|yxkO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTATCCCTCCTCTGC, downstream forward: _UP4_TTTGAATGATAAAAAAGCTG
  • BKK38720 (Δ[gene|0A9C77804C09CD5E7D1D5D274E01B5B14920A1A9|yxkO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTATCCCTCCTCTGC, downstream forward: _UP4_TTTGAATGATAAAAAAGCTG
  • References

  • 15805528,10746760,12457846,22940582,25393291,17702456