SubtiBank SubtiBank
yxkO
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yxkO

ADP/ATP-dependent NAD(P)H-hydrate dehydratase, general stress protein, survival of ethanol stress
locus
BSU_38720
pI
5.49
mw
29.72 kDa
protein length
276 aa Sequence Blast
gene length
831 bp Sequence Blast
function
survival of ethanol stress, repair of hydrated NAD(P)H
product
ADP/ATP-dependent NAD(P)H-hydrate dehydratase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • Gene

    Coordinates
    3,972,448 3,973,278

    The protein

    Catalyzed reaction/ biological activity

  • (6S)-NADHX + ADP --> AMP + H+ + NADH + phosphate (according to UniProt)
  • (6S)-NADPHX + ADP --> AMP + H+ + NADPH + phosphate (according to UniProt)
  • Protein family

  • NnrD/CARKD family (single member, according to UniProt)
  • [SW|Domains]

  • YjeF C-terminal domain (aa 7-275) (according to UniProt)
  • Structure

  • [PDB|1KYH] [pubmed|12457846]
  • Expression and Regulation

    Operons

    genes
    [gene|0A9C77804C09CD5E7D1D5D274E01B5B14920A1A9|yxkO]
    description
    [Pubmed|10746760]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B749 (yxkO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1748 NBRP B. subtilis, Japan]
  • BKE38720 ([gene|0A9C77804C09CD5E7D1D5D274E01B5B14920A1A9|yxkO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTATCCCTCCTCTGC, downstream forward: _UP4_TTTGAATGATAAAAAAGCTG
  • BKK38720 ([gene|0A9C77804C09CD5E7D1D5D274E01B5B14920A1A9|yxkO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTATCCCTCCTCTGC, downstream forward: _UP4_TTTGAATGATAAAAAAGCTG
  • References

  • 15805528,10746760,12457846,22940582,25393291,17702456