SubtiBank SubtiBank
yfkH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yfkH

general stress protein, survival of ethanol and paraquat stresses
locus
BSU07900
pI
8.42
mw
30.32 kDa
protein length
275 aa Sequence Blast
gene length
828 bp Sequence Blast
function
survival of stress conditions
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    862,836 863,663

    The protein

    [SW|Localization]

  • membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|2CEFD8D9692D062CC09E3DEDA1A4015C76BC4167|yfkJ]-[gene|A38D85EE1BCCA5E5E77CAF9583E7D052BB7F8188|yfkI]-[gene|0A9352AB10C7DC06BF477EBE384D6E21D920AAC8|yfkH]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11532142], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528,11532142], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|15805528,11532142]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C268 (yfkH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2266 NBRP B. subtilis, Japan]
  • BKE07900 ([gene|0A9352AB10C7DC06BF477EBE384D6E21D920AAC8|yfkH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCGTCTCACCTCGCAT, downstream forward: _UP4_TAGCGCACCCTATAAACGAA
  • BKK07900 ([gene|0A9352AB10C7DC06BF477EBE384D6E21D920AAC8|yfkH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCGTCTCACCTCGCAT, downstream forward: _UP4_TAGCGCACCCTATAAACGAA
  • References

  • 15805528,11532142,22582280