SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


general stress protein, survival of ethanol and paraquat stresses
30.32 kDa
protein length
275 aa Sequence Blast
gene length
828 bp Sequence Blast
survival of stress conditions

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    862,836 863,663

    The protein


  • membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11532142], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528,11532142], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|15805528,11532142]
  • view in new tab

    Biological materials


  • MGNA-C268 (yfkH::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE07900 ([gene|0A9352AB10C7DC06BF477EBE384D6E21D920AAC8|yfkH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCGTCTCACCTCGCAT, downstream forward: _UP4_TAGCGCACCCTATAAACGAA
  • BKK07900 ([gene|0A9352AB10C7DC06BF477EBE384D6E21D920AAC8|yfkH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCGTCTCACCTCGCAT, downstream forward: _UP4_TAGCGCACCCTATAAACGAA
  • References

  • 15805528,11532142,22582280