SubtiBank SubtiBank
lplC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

lplC

transmembrane lipoprotein, putative [SW|ABC transporter] (membrane protein)
locus
BSU_07120
pI
9.51
mw
32.68 kDa
protein length
295 aa Sequence Blast
gene length
888 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.4|Unknown ABC transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    782,062 782,949

    The protein

    Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • [SW|CysTW subfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|87B212C8C61483DF2874762A3B77111616C616A5|YtcP]
  • [SW|Domains]

  • [SW|ABC transmembrane type-1 domain] (aa 79-280) (according to UniProt)
  • Structure

  • [PDB|4TQU] (from Sphingomonas sp., 33% identity) [pubmed|26235029]
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Biological materials

    Mutant

  • BKE07120 ([gene|0A7FF3E2747598AE0EE39183E8827879C4B11A80|lplC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATTTCAGCCATACCTCTCC, downstream forward: _UP4_TCGGTGAAAGGCTGAGAAAG
  • BKK07120 ([gene|0A7FF3E2747598AE0EE39183E8827879C4B11A80|lplC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATTTCAGCCATACCTCTCC, downstream forward: _UP4_TCGGTGAAAGGCTGAGAAAG
  • References

  • 10092453,26235029