SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


24.39 kDa
protein length
227 aa Sequence Blast
gene length
684 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    3,775,653 3,776,336

    The protein

    Paralogous protein(s)

  • [protein|D8A9FB28570ECD941CD79265888342DC3B623CC3|YwmD]
  • [SW|Domains]

  • [SW|VWFA domain] (aa 36-227) (according to UniProt)
  • Structure

  • [PDB|4RCK] (from Vibrio fischeri, 23% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A211 (ywnC(G)::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE36740 ([gene|0A621182C7AD39530BE6F2A63560FB9CBAA9C754|ywmC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCGTACCCCTTTACC, downstream forward: _UP4_TAAGAAAAAAGAGGCTGGTG
  • BKK36740 ([gene|0A621182C7AD39530BE6F2A63560FB9CBAA9C754|ywmC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCGTACCCCTTTACC, downstream forward: _UP4_TAAGAAAAAAGAGGCTGGTG
  • References

  • 9353933