SubtiBank SubtiBank
ywmC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywmC

unknown
locus
BSU_36740
pI
9.07
mw
24.39 kDa
protein length
227 aa Sequence Blast
gene length
684 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,775,653 3,776,336

    The protein

    Paralogous protein(s)

  • [protein|D8A9FB28570ECD941CD79265888342DC3B623CC3|YwmD]
  • [SW|Domains]

  • [SW|VWFA domain] (aa 36-227) (according to UniProt)
  • Structure

  • [PDB|4RCK] (from Vibrio fischeri, 23% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|0A621182C7AD39530BE6F2A63560FB9CBAA9C754|ywmC]
    description
    [Pubmed|9353933]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A211 (ywnC(G)::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/211 NBRP B. subtilis, Japan]
  • BKE36740 ([gene|0A621182C7AD39530BE6F2A63560FB9CBAA9C754|ywmC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCGTACCCCTTTACC, downstream forward: _UP4_TAAGAAAAAAGAGGCTGGTG
  • BKK36740 ([gene|0A621182C7AD39530BE6F2A63560FB9CBAA9C754|ywmC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCGTACCCCTTTACC, downstream forward: _UP4_TAAGAAAAAAGAGGCTGGTG
  • References

  • 9353933