SubtiBank SubtiBank
glxB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

glxB

glyoxalase II
locus
BSU_32660
pI
4.61
mw
14.30 kDa
protein length
127 aa Sequence Blast
gene length
384 bp Sequence Blast
function
detoxification of methylglyoxal
product
glyoxalase II
essential
no
synonyms
yurT

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    3,354,551 3,354,934

    The protein

    Catalyzed reaction/ biological activity

  • S-lactoyl-bacillithiol (BSH) - D-lactate + BSH [Pubmed|24330391]
  • Protein family

  • glyoxalase I family (with [protein|54E05955FF1732F434A0FAB08967573B8DD3ADD2|GlxA] and [protein|F02D4AFF60ADDDC5F5B85A3ACCA3AF803560B91E|YraH], according to UniProt)
  • Structure

  • [PDB|4G6X] (from Catenulispora acidiphila, 53% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|85E5D3211F27DA64C4E829385C6A08F4A4A2F874|yuzN]-[gene|0A244A61A9A484F0BF083C918AE5A2C6A3F8157E|glxB]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B582 (yurT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1581 NBRP B. subtilis, Japan]
  • BKE32660 ([gene|0A244A61A9A484F0BF083C918AE5A2C6A3F8157E|glxB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTGTTTTTCCCTCCTT, downstream forward: _UP4_TAACCGATTCAGTCGCGTCC
  • BKK32660 ([gene|0A244A61A9A484F0BF083C918AE5A2C6A3F8157E|glxB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTGTTTTTCCCTCCTT, downstream forward: _UP4_TAACCGATTCAGTCGCGTCC
  • References

  • 24330391