SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


glyoxalase II
14.30 kDa
protein length
127 aa Sequence Blast
gene length
384 bp Sequence Blast
detoxification of methylglyoxal
glyoxalase II

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    3,354,551 3,354,934

    The protein

    Catalyzed reaction/ biological activity

  • S-lactoyl-bacillithiol (BSH) - D-lactate + BSH [Pubmed|24330391]
  • Structure

  • [PDB|4G6X] (from Catenulispora acidiphila, 53% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B582 (yurT::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32660 ([gene|0A244A61A9A484F0BF083C918AE5A2C6A3F8157E|glxB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTGTTTTTCCCTCCTT, downstream forward: _UP4_TAACCGATTCAGTCGCGTCC
  • BKK32660 ([gene|0A244A61A9A484F0BF083C918AE5A2C6A3F8157E|glxB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTGTTTTTCCCTCCTT, downstream forward: _UP4_TAACCGATTCAGTCGCGTCC
  • References

  • 24330391