SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


tRNA isopentenylpyrophosphate transferase
35.52 kDa
protein length
314 aa Sequence Blast
gene length
945 bp Sequence Blast
tRNA modification
tRNA isopentenylpyrophosphate transferase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|tRNA modification and maturation]
  • Gene

    1,866,389 1,867,333

    Phenotypes of a mutant

  • inactivation of ''[gene|09C9CDA3EA23B751C7135DEDF0FE2563BA69FF1D|miaA]'' reduces sporulation efficiency to 16% that of wild type cells [Pubmed|26735940]
  • The protein

    Catalyzed reaction/ biological activity

  • adenosine37 in tRNA + dimethylallyl diphosphate --> diphosphate + N6-dimethylallyladenosine37 in tRNA (according to UniProt)
  • Protein family

  • IPP transferase family (single member, according to UniProt)
  • Structure

  • [PDB|2QGN] (from ''Bacillus halodurans'', 57% identity)
  • Expression and Regulation


    view in new tab



  • expressed during [SW|sporulation ][Pubmed|22383849]
  • view in new tab

    Biological materials


  • BKE17330 ([gene|09C9CDA3EA23B751C7135DEDF0FE2563BA69FF1D|miaA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATATGTATCACTCTCTTT, downstream forward: _UP4_TAATCGAAACTGTATGATAT
  • BKK17330 ([gene|09C9CDA3EA23B751C7135DEDF0FE2563BA69FF1D|miaA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATATGTATCACTCTCTTT, downstream forward: _UP4_TAATCGAAACTGTATGATAT
  • References

    The corresponding gene/ protein in other bacteria

  • 11160115,3045085,9294434,26735940