SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


tRNA isopentenylpyrophosphate transferase
35.52 kDa
protein length
314 aa Sequence Blast
gene length
945 bp Sequence Blast
tRNA modification
tRNA isopentenylpyrophosphate transferase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|tRNA modification and maturation]
  • Gene

    1,866,389 1,867,333

    Phenotypes of a mutant

  • inactivation of ''[gene|09C9CDA3EA23B751C7135DEDF0FE2563BA69FF1D|miaA]'' reduces sporulation efficiency to 16% that of wild type cells [Pubmed|26735940]
  • The protein

    Catalyzed reaction/ biological activity

  • adenosine37 in tRNA + dimethylallyl diphosphate --> diphosphate + N6-dimethylallyladenosine37 in tRNA (according to UniProt)
  • Protein family

  • IPP transferase family (single member, according to UniProt)
  • Structure

  • [PDB|2QGN] (from ''Bacillus halodurans'', 57% identity)
  • Expression and Regulation


    view in new tab



  • expressed during [SW|sporulation ][Pubmed|22383849]
  • view in new tab

    Biological materials


  • BKE17330 ([gene|09C9CDA3EA23B751C7135DEDF0FE2563BA69FF1D|miaA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATATGTATCACTCTCTTT, downstream forward: _UP4_TAATCGAAACTGTATGATAT
  • BKK17330 ([gene|09C9CDA3EA23B751C7135DEDF0FE2563BA69FF1D|miaA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATATGTATCACTCTCTTT, downstream forward: _UP4_TAATCGAAACTGTATGATAT
  • References

    The corresponding gene/ protein in other bacteria

  • 11160115,3045085,9294434,26735940