SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


bifunctional signal peptidase I that controls surface-adhered [SW|biofilm formation] and processes [protein|BF97457E986656E4A9FE7A858F5BDF1759850D5C|TasA] and [protein|8C13E1EF5437DD8F9906643DEDCBB18DABE3B9E3|TapA]
20.53 kDa
protein length
190 aa Sequence Blast
gene length
573 bp Sequence Blast
[SW|biofilm formation]
signal peptidase I

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.5|Protein secretion]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Amyloid protein synthesis, secretion and assembly]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,553,930 2,554,502

    The protein

    Catalyzed reaction/ biological activity

  • important for [SW|biofilm formation] on a solid surface, but not required at an air-liquid interface [Pubmed|22328672]
  • Cleavage of hydrophobic, N-terminal signal or leader sequences from [protein|BF97457E986656E4A9FE7A858F5BDF1759850D5C|TasA] and [protein|8C13E1EF5437DD8F9906643DEDCBB18DABE3B9E3|TapA] [Pubmed|10049401,10559173]
  • Protein family

  • peptidase S26B family (single member, according to UniProt)
  • [SW|Localization]

  • membrane [Pubmed|22328672]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16430695], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [PubMed|10464223,17720793], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [Pubmed|16430695], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]: activation, [Pubmed|23646920], in [regulon|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA regulon]
  • [protein|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|LutR]: activation, [Pubmed|24196425], in [regulon|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|LutR regulon]
  • regulation

  • repressed by casamino acids [Pubmed|12107147]
  • additional information

  • induction by sequestration of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] by [protein|24D6A7DDCB25B99FBB670E9203F826596916B35C|SinI] or [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|SlrA] [PubMed|15661000,19788541] or by SlrR [PubMed|20351052]
  • expression of the operon is localized to a ring near the periphery of the biofilm [pubmed|29590605]
  • view in new tab

    Biological materials


  • MGNA-C439 (yqhE::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A937 ( ''sipW''::''kan''), [Pubmed|15101989], available at [ BGSC]
  • BKE24630 ([gene|09B082BF39703F0D9A5980E643175DBD59F5B228|sipW]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGTAAAGATGATCACGTATA, downstream forward: _UP4_TAACTTCAGTTGTAAACCTG
  • BKK24630 ([gene|09B082BF39703F0D9A5980E643175DBD59F5B228|sipW]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGTAAAGATGATCACGTATA, downstream forward: _UP4_TAACTTCAGTTGTAAACCTG
  • labs

  • [SW|Beth Lazazzera], Los Angeles, USA
  • References


  • 21488983,22427624,22688815
  • Original publications

  • 22328672,18047568,15175311,16430695,10368135,9694797,18430133,18647168,10464223,17720793,20351052,10827084,21477127,10559173,23646920,21856853,21815947,29590605