SubtiBank SubtiBank
sipW
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

sipW

bifunctional signal peptidase I that controls surface-adhered [SW|biofilm formation] and processes [protein|BF97457E986656E4A9FE7A858F5BDF1759850D5C|TasA] and [protein|8C13E1EF5437DD8F9906643DEDCBB18DABE3B9E3|TapA]
locus
BSU_24630
pI
5.49
mw
20.53 kDa
protein length
190 aa Sequence Blast
gene length
573 bp Sequence Blast
function
[SW|biofilm formation]
product
signal peptidase I
essential
no
synonyms
yqhE

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.5|Protein secretion]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.2|Amyloid protein synthesis, secretion and assembly]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,553,930 2,554,502

    The protein

    Catalyzed reaction/ biological activity

  • important for [SW|biofilm formation] on a solid surface, but not required at an air-liquid interface [Pubmed|22328672]
  • Cleavage of hydrophobic, N-terminal signal or leader sequences from [protein|BF97457E986656E4A9FE7A858F5BDF1759850D5C|TasA] and [protein|8C13E1EF5437DD8F9906643DEDCBB18DABE3B9E3|TapA] [Pubmed|10049401,10559173]
  • Protein family

  • peptidase S26B family (single member, according to UniProt)
  • [SW|Localization]

  • membrane [Pubmed|22328672]
  • Expression and Regulation

    Operons

    genes
    [gene|8C13E1EF5437DD8F9906643DEDCBB18DABE3B9E3|tapA]-[gene|09B082BF39703F0D9A5980E643175DBD59F5B228|sipW]-[gene|BF97457E986656E4A9FE7A858F5BDF1759850D5C|tasA]
    description
    [Pubmed|16430695]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16430695], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [PubMed|10464223,17720793], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [Pubmed|16430695], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]: activation, [Pubmed|23646920], in [regulon|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA regulon]
  • [protein|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|LutR]: activation, [Pubmed|24196425], in [regulon|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|LutR regulon]
  • regulation

  • repressed by casamino acids [Pubmed|12107147]
  • additional information

  • induction by sequestration of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] by [protein|24D6A7DDCB25B99FBB670E9203F826596916B35C|SinI] or [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|SlrA] [PubMed|15661000,19788541] or by SlrR [PubMed|20351052]
  • expression of the operon is localized to a ring near the periphery of the biofilm [pubmed|29590605]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C439 (yqhE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2437 NBRP B. subtilis, Japan]
  • 1A937 ( ''sipW''::''kan''), [Pubmed|15101989], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A937&Search=1A937 BGSC]
  • BKE24630 ([gene|09B082BF39703F0D9A5980E643175DBD59F5B228|sipW]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGTAAAGATGATCACGTATA, downstream forward: _UP4_TAACTTCAGTTGTAAACCTG
  • BKK24630 ([gene|09B082BF39703F0D9A5980E643175DBD59F5B228|sipW]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGTAAAGATGATCACGTATA, downstream forward: _UP4_TAACTTCAGTTGTAAACCTG
  • labs

  • [SW|Beth Lazazzera], Los Angeles, USA
  • References

    Reviews

  • 21488983,22427624,22688815
  • Original publications

  • 22328672,18047568,15175311,16430695,10368135,9694797,18430133,18647168,10464223,17720793,20351052,10827084,21477127,10559173,23646920,21856853,21815947,29590605