SubtiBank SubtiBank
yraA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yraA

general stress protein, degradation of damaged thiol-containing proteins, glyoxalase III-like enzyme
locus
BSU27020
pI
4.73
mw
18.37 kDa
protein length
169 aa Sequence Blast
gene length
510 bp Sequence Blast
function
detoxification of methylglyoxal
product
glyoxalase III-like enzyme
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.4|Additional proteins involved in proteolysis]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    2,757,492 2,758,001

    The protein

    Catalyzed reaction/ biological activity

  • methylglyoxal - D-lactate [Pubmed|24330391]
  • Protein family

  • peptidase C56 family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|F88F0153CAFC1E51F2586F733AFDF22320642151|YfkM]
  • Structure

  • [PDB|4Y0N] (from Staphylococcus aureus, 57% identity) [pubmed|26487697]
  • Expression and Regulation

    Operons

    genes
    [gene|BEF882B7B846E3B8BF4C08FBF0DBB9F5A2CA2604|yrzP]-[gene|352544F3E79943E94E28A6EB5F4C543B529A02D1|adhA]-[gene|0960F1856A81237DBA6AF1FAF36172A63ECBE2D5|yraA]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|0960F1856A81237DBA6AF1FAF36172A63ECBE2D5|yraA]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|17434969], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • regulatory mechanism

  • [protein|B24BA6ABCAF7325EC5F8B2655CA182FFC23395FD|AdhR]: activation, [Pubmed|19170879], in [regulon|B24BA6ABCAF7325EC5F8B2655CA182FFC23395FD|AdhR regulon]
  • regulation

  • ''[protein|search|adhA]'': induced in the presence of the toxic carbonyls methylglyoxal and formaldehyde ([protein|search|AdhR]) [Pubmed|19170879]
  • view in new tab

    genes
    [gene|352544F3E79943E94E28A6EB5F4C543B529A02D1|adhA]-[gene|0960F1856A81237DBA6AF1FAF36172A63ECBE2D5|yraA]
    description
    [Pubmed|19170879]

    regulatory mechanism

  • [protein|B24BA6ABCAF7325EC5F8B2655CA182FFC23395FD|AdhR]: activation, [Pubmed|19170879], in [regulon|B24BA6ABCAF7325EC5F8B2655CA182FFC23395FD|AdhR regulon]
  • regulation

  • ''[protein|search|adhA]'': induced in the presence of the toxic carbonyls methylglyoxal and formaldehyde ([protein|search|AdhR]) [Pubmed|19170879]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A239 (yraA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/239 NBRP B. subtilis, Japan]
  • BKE27020 ([gene|0960F1856A81237DBA6AF1FAF36172A63ECBE2D5|yraA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAACCCTCCTAATA, downstream forward: _UP4_TAACAAGAAGGCACAGACTG
  • BKK27020 ([gene|0960F1856A81237DBA6AF1FAF36172A63ECBE2D5|yraA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAACCCTCCTAATA, downstream forward: _UP4_TAACAAGAAGGCACAGACTG
  • References

  • 17434969,19170879,22582280,15805528,17434969,24330391,26487697