SubtiBank SubtiBank
patA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

patA

N-acetyl-L,L-diaminopimelate aminotransferase
locus
BSU_14000
pI
6.01
mw
43.29 kDa
protein length
393 aa Sequence Blast
gene length
1182 bp Sequence Blast
function
biosynthesis of lysine and peptidoglycan
product
aminotransferase
essential
yes
ec
2.6.1.-
synonyms
uat,dapX

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.1|Biosynthesis of peptidoglycan]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.6|Biosynthesis/ acquisition of lysine/ threonine]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.1|Biosynthesis of peptidoglycan]
  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • Gene

    Coordinates
    1,471,857 1,473,038

    Phenotypes of a mutant

  • essential [Pubmed|23109554]
  • The protein

    Catalyzed reaction/ biological activity

  • N-acetyl-2-amino-6-ketopimelate - N-acetyl-L,L-2,6-diaminopimelate [Pubmed|24261876]
  • 2-oxoglutarate + N-acetyl-LL-2,6-diaminoheptanedioate --> L-2-acetamido-6-oxoheptanedioate + L-glutamate (according to UniProt)
  • Protein family

  • [SW|class-I pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|62A9CD9AF72D0A48EC5ABC1585E2D8636D36D021|AlaT], [protein|AE802E1D4F827DED3A5D953C7D034E6A3554C45F|AspB]
  • [SW|Cofactors]

  • PLP
  • Structure

  • [PDB|1GDE] (from Pyrococcus sp., 42% identity) [pubmed|11134972]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|094AE3AC8DFAFC8048ADAAB34F76DF2562D80CE7|patA]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|5B177CBC33203B5B2DA841097CEB29B3A3C37C08|ykzT]-[gene|094AE3AC8DFAFC8048ADAAB34F76DF2562D80CE7|patA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE14000 ([gene|094AE3AC8DFAFC8048ADAAB34F76DF2562D80CE7|patA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTCATCACCTTAACA, downstream forward: _UP4_AACAACGGCGTTTAAGCCGT
  • References

  • 24261876,23109554,11134972,29280348