SubtiBank SubtiBank
patA
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

patA

N-acetyl-L,L-diaminopimelate aminotransferase
locus
BSU14000
pI
6.01
mw
43.29 kDa
protein length
392 aa Sequence Blast
gene length
1176 bp Sequence Blast
function
biosynthesis of lysine and peptidoglycan
product
aminotransferase
essential
yes
ec
2.6.1.-
synonyms
uat,dapX

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.1|Biosynthesis of peptidoglycan]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.6|Biosynthesis/ acquisition of lysine/ threonine]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.1|Biosynthesis of peptidoglycan]
  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • Gene

    Coordinates
    1,471,857 → 1,473,038

    Phenotypes of a mutant

  • essential [Pubmed|23109554]
  • The protein

    Catalyzed reaction/ biological activity

  • N-acetyl-2-amino-6-ketopimelate -→ N-acetyl-L,L-2,6-diaminopimelate [Pubmed|24261876]
  • Protein family

  • class-I pyridoxal-phosphate-dependent aminotransferase family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|62A9CD9AF72D0A48EC5ABC1585E2D8636D36D021|AlaT] (45%)
  • Structure

  • [PDB|1GDE] (from Pyrococcus sp., 42% identity) [pubmed|11134972]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Biological materials

    Mutant

  • BKE14000 (Δ[gene|094AE3AC8DFAFC8048ADAAB34F76DF2562D80CE7|patA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTCATCACCTTAACA, downstream forward: _UP4_AACAACGGCGTTTAAGCCGT
  • References

  • 24261876,23109554,11134972,29280348