SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


N-acetyl-L,L-diaminopimelate aminotransferase
43.29 kDa
protein length
392 aa Sequence Blast
gene length
1176 bp Sequence Blast
biosynthesis of lysine and peptidoglycan

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Biosynthesis of peptidoglycan]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of lysine/ threonine]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW|Biosynthesis of peptidoglycan]
  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • Gene

    1,471,857 → 1,473,038

    Phenotypes of a mutant

  • essential [Pubmed|23109554]
  • The protein

    Catalyzed reaction/ biological activity

  • N-acetyl-2-amino-6-ketopimelate -→ N-acetyl-L,L-2,6-diaminopimelate [Pubmed|24261876]
  • Protein family

  • [SW|class-I pyridoxal-phosphate-dependent aminotransferase family] (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|62A9CD9AF72D0A48EC5ABC1585E2D8636D36D021|AlaT]:
  • [SW|Cofactors]

  • PLP
  • Structure

  • [PDB|1GDE] (from Pyrococcus sp., 42% identity) [pubmed|11134972]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab

    view in new tab

    Biological materials


  • BKE14000 (Δ[gene|094AE3AC8DFAFC8048ADAAB34F76DF2562D80CE7|patA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTCATCACCTTAACA, downstream forward: _UP4_AACAACGGCGTTTAAGCCGT
  • References

  • 24261876,23109554,11134972,29280348