SubtiBank SubtiBank
ypdQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ypdQ

similar to RNase HI
locus
BSU_21990
pI
5.62
mw
14.53 kDa
protein length
132 aa Sequence Blast
gene length
399 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.2|DNA replication/ based on similarity]
  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.5|RNase/ based on similarity]
  • Gene

    Coordinates
    2,310,419 2,310,817

    The protein

    Protein family

  • RNase H family (single member, according to UniProt)
  • Structure

  • [PDB|1GOC] (RNase HI from E. coli, 30% identity) [pubmed|8393706]
  • Expression and Regulation

    Operons

    genes
    [gene|7DD4BB8222B2EFE81C32C5521A29256095B9D6C1|ypdP]-[gene|09343BE8357AB24C79B69816FAE65D161E668F01|ypdQ]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A871 (ypdQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/871 NBRP B. subtilis, Japan]
  • BKE21990 ([gene|09343BE8357AB24C79B69816FAE65D161E668F01|ypdQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCTACATATATTTCTGTAG, downstream forward: _UP4_TAAATCTTGATCATTGGTTC
  • BKK21990 ([gene|09343BE8357AB24C79B69816FAE65D161E668F01|ypdQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCTACATATATTTCTGTAG, downstream forward: _UP4_TAAATCTTGATCATTGGTTC
  • References

  • 22383849,29084857,8393706