SubtiBank SubtiBank
ypdQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ypdQ

similar to RNase HI
locus
BSU21990
pI
5.62
mw
14.53 kDa
protein length
132 aa Sequence Blast
gene length
399 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.2|DNA replication/ based on similarity]
  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.5|RNase/ based on similarity]
  • Gene

    Coordinates
    2,310,419 2,310,817

    The protein

    Structure

  • [PDB|1GOC] (RNase HI from E. coli, 30% identity) [pubmed|8393706]
  • Expression and Regulation

    Operons

    genes
    [gene|7DD4BB8222B2EFE81C32C5521A29256095B9D6C1|ypdP]-[gene|09343BE8357AB24C79B69816FAE65D161E668F01|ypdQ]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A871 (ypdQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/871 NBRP B. subtilis, Japan]
  • BKE21990 ([gene|09343BE8357AB24C79B69816FAE65D161E668F01|ypdQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCTACATATATTTCTGTAG, downstream forward: _UP4_TAAATCTTGATCATTGGTTC
  • BKK21990 ([gene|09343BE8357AB24C79B69816FAE65D161E668F01|ypdQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCTACATATATTTCTGTAG, downstream forward: _UP4_TAAATCTTGATCATTGGTTC
  • References

  • 22383849,29084857,8393706