SubtiBank SubtiBank
ykuN
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ykuN

flavodoxin, binds FMN, replaces ferredoxin under conditions of iron limitation, probably involved in electron transfer to nitric oxide synthase
locus
BSU14150
pI
3.83
mw
17.65 kDa
protein length
158 aa Sequence Blast
gene length
477 bp Sequence Blast
function
electron transfer
product
flavodoxin
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.3|Electron transport/ other]
  • Gene

    Coordinates
    1,487,038 1,487,514

    The protein

    Protein family

  • flavodoxin-like domain (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|ECAFD2873ADE6B65C7B3C27FF26E0FAAA74839CC|YkuP]
  • [SW|Cofactors]

  • FMN [Pubmed|25194416]
  • Structure

  • [PDB|5LJL] (flavodoxin from Streptococcus pneumoniae, 42% identity) [pubmed|27649488]
  • Expression and Regulation

    Operons

    genes
    [gene|0932DDC285635C02067A3302CEDA302FE4269179|ykuN]-[gene|CEC1B5DF1E548597FE333895ECA476AB9DFFFDD7|ykuO]-[gene|ECAFD2873ADE6B65C7B3C27FF26E0FAAA74839CC|ykuP]
    description
    [Pubmed|12354229]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12354229], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI]: sigma factor, [pubmed|29914988], in [regulon|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI regulon]
  • regulatory mechanism

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|24214949], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|65E2F7197D46F5C884CC96018EE4F3EEE94FFA18|Kre]: repression, in [regulon|65E2F7197D46F5C884CC96018EE4F3EEE94FFA18|Kre regulon]
  • [protein|EC6697D5D945B7E5083AFED9218748763C443278|NsrR]: repression, [Pubmed|24214949], in [regulon|EC6697D5D945B7E5083AFED9218748763C443278|NsrR regulon]
  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]) [Pubmed|24214949]
  • induced by iron starvation (second wave) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]) [pubmed|29133393,12354229]
  • expression of the operon is strongly induced at the beginning of [SW|biofilm formation] [pubmed|31113899]
  • additional information

  • the ''[protein|0932DDC285635C02067A3302CEDA302FE4269179|YkuN]-[protein|CEC1B5DF1E548597FE333895ECA476AB9DFFFDD7|YkuO]-[protein|ECAFD2873ADE6B65C7B3C27FF26E0FAAA74839CC|YkuP]'' operon is strongly unregulated in a ''[SW|kre]'' mutant [Pubmed|26110430]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B337 (ykuN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1336 NBRP B. subtilis, Japan]
  • BKE14150 ([gene|0932DDC285635C02067A3302CEDA302FE4269179|ykuN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTATCACCCCATTAGT, downstream forward: _UP4_GATTATATGAACAAGGAAAA
  • BKK14150 ([gene|0932DDC285635C02067A3302CEDA302FE4269179|ykuN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTATCACCCCATTAGT, downstream forward: _UP4_GATTATATGAACAAGGAAAA
  • References

  • 15449930,17127770,12354229,20186410,24214949,21665975,25194416,25933252,26110430,28439033,27649488,29133393,29914988,31113899