SubtiBank SubtiBank
ypmA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ypmA

unknown
locus
BSU_22390
pI
4.68
mw
6.42 kDa
protein length
gene length
171 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,349,358 2,349,528

    Expression and Regulation

    Operons

    genes
    [gene|08F907C6F47BDEB4DC9A9F136CDC6A4063AC0140|ypmA]-[gene|D3629004F3B54D11566AE15227174F9EB7784201|tseB]-[gene|AE802E1D4F827DED3A5D953C7D034E6A3554C45F|aspB]
    description
    [Pubmed|29995990,22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE22390 ([gene|08F907C6F47BDEB4DC9A9F136CDC6A4063AC0140|ypmA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCATCCTCCAGTT, downstream forward: _UP4_ATTTATCGTACGTAGGTGAG
  • BKK22390 ([gene|08F907C6F47BDEB4DC9A9F136CDC6A4063AC0140|ypmA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCATCCTCCAGTT, downstream forward: _UP4_ATTTATCGTACGTAGGTGAG