SubtiBank SubtiBank
bceS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

bceS

two-component sensor kinase, regulation of [gene|8E0DE8FE7E9C12495C4DCADA74D838FED088867D|bceA]-[gene|search|bceB ]in response to bacitracin, plectasin, mersacidin and actagardine
locus
BSU_30390
pI
5.94
mw
38.61 kDa
protein length
334 aa Sequence Blast
gene length
1005 bp Sequence Blast
function
resistance against toxic peptides
product
two-component sensor kinase
essential
no
synonyms
ytsB

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.2|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.1|Two-component sensor kinase]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    Coordinates
    3,112,190 3,113,194

    The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, phosphorylation of [protein|C239C155F5452C86BF6C78190BABBBB07A63DF87|BceR]
  • [SW|Domains]

  • two transmembrane segments, C-terminal histidine phosphotransferase domain
  • Modification

  • autophosphorylation on a His residue
  • Effectors of protein activity

  • binding of [protein|E3613A6C8B5F0EC76510ACE3E478967E73E2B241|BceB] in the absence of bacitracin inhibits [protein|08F24CA21DC54031F6158AC0C772F3B520E5A849|BceS] autophosphorylation [Pubmed|25118291]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|C239C155F5452C86BF6C78190BABBBB07A63DF87|bceR]-[gene|08F24CA21DC54031F6158AC0C772F3B520E5A849|bceS]
    description
    [Pubmed|12399481]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A166 (ytsB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/166 NBRP B. subtilis, Japan]
  • BKE30390 ([gene|08F24CA21DC54031F6158AC0C772F3B520E5A849|bceS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCTCCGCCTTTCGATAAGGA, downstream forward: _UP4_TGACGAAAATGTCACATGCT
  • BKK30390 ([gene|08F24CA21DC54031F6158AC0C772F3B520E5A849|bceS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCTCCGCCTTTCGATAAGGA, downstream forward: _UP4_TGACGAAAATGTCACATGCT
  • References

    Reviews

  • 27344142,28152228,29404338
  • Original publications

  • 10094672,18394148,12890034,14651641,21283517,20606066,22964256,21078927,17905982,23687272,25118291,26199330