SubtiBank SubtiBank
comK
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

comK

competence transcription factor (CTF)
locus
BSU_10420
pI
7.67
mw
22.28 kDa
protein length
192 aa Sequence Blast
gene length
579 bp Sequence Blast
function
regulation of [SW|genetic competence] and DNA uptake
product
competence transcription factor (CTF)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    1,117,109 1,117,687

    Phenotypes of a mutant

  • no expression of competence genes, loss of [SW|genetic competence] [Pubmed|7783616]
  • The protein

    Modification

  • phosphorylated on Arg-65, Arg-157, Arg-161, Arg-165, Arg-186, and Arg-191 [Pubmed|22517742]
  • additional information

  • degraded by [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] (with [protein|331993A875907C10C77105FD8DDD86D4412CE405|MecA] as adaptor protein) [PubMed|9890793]
  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000023 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK]
    description
    [Pubmed|8196543]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8196543], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [Pubmed|11849533], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|8830686], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|12586407], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, (autoregulation) [Pubmed|8083168], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]-P, acts as antagonist of [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok] [Pubmed|22412392], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • [gene|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK] has a bistable expression pattern [Pubmed|26110430]
  • expression is reduced in a [gene|search|cwlO ]mutant [pubmed|29553055]
  • view in new tab

    additional information

  • full expression of [gene|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK] requires fully assembled and rotating flagella [pubmed|28800172]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P represses comK expression [pubmed|28800172]
  • Biological materials

    Mutant

  • 1A871 (no resistance), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A871&Search=1A871 BGSC]
  • BKE10420 ([gene|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTATGGCCTCCATCCT, downstream forward: _UP4_TAGAAAAATAGGAAGGAGCT
  • BKK10420 ([gene|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTATGGCCTCCATCCT, downstream forward: _UP4_TAGAAAAATAGGAAGGAGCT
  • Expression vectors

  • for expression, purification in E. coli with N-terminal His-tag, pRSETA available in Gerth lab
  • labs

  • [SW|Oscar Kuipers], University of Groningen, The Netherlands
  • [http://molgen.biol.rug.nl/molgen/index.php Homepage]
  • References

    Reviews

  • 19995980,12576575,26110607,31950915
  • The [SW|ComK regulon]

  • 11948146,11918817
  • Original Publications

  • 8878039,11849533,17569828,9335269,17560370,12586407,11814663,9108277,9890793,9585513,15819619,10908654,9000055,7746142,8830686,10447896,12028382,8016067,10361283,11703662,12107147,17581123,8016066,17493123,16391071,16436435,12270822,15598897,20300532,12761164,12036071,21085679,22517742,7783616,22412392,8083168,24838881,8196543,26110430,27045827,27920766,28800172,29124898,29553055