SubtiBank SubtiBank
comK
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

comK

competence transcription factor (CTF)
locus
BSU_10420
pI
7.67
mw
22.28 kDa
protein length
192 aa Sequence Blast
gene length
579 bp Sequence Blast
function
regulation of [SW|genetic competence] and DNA uptake
product
competence transcription factor (CTF)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    1,117,109 1,117,687

    Phenotypes of a mutant

  • no expression of competence genes, loss of [SW|genetic competence] [Pubmed|7783616]
  • The protein

    Modification

  • phosphorylated on Arg-65, Arg-157, Arg-161, Arg-165, Arg-186, and Arg-191 [Pubmed|22517742]
  • additional information

  • degraded by [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] (with [protein|331993A875907C10C77105FD8DDD86D4412CE405|MecA] as adaptor protein) [PubMed|9890793]
  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000023 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK]
    description
    [Pubmed|8196543]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8196543], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [Pubmed|11849533], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|8830686], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|12586407], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, (autoregulation) [Pubmed|8083168], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]-P, acts as antagonist of [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok] [Pubmed|22412392], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • [gene|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK] has a bistable expression pattern [Pubmed|26110430]
  • expression is reduced in a [gene|search|cwlO ]mutant [pubmed|29553055]
  • view in new tab

    additional information

  • full expression of [gene|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK] requires fully assembled and rotating flagella [pubmed|28800172]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P represses comK expression [pubmed|28800172]
  • Biological materials

    Mutant

  • 1A871 (no resistance), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A871&Search=1A871 BGSC]
  • BKE10420 ([gene|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTATGGCCTCCATCCT, downstream forward: _UP4_TAGAAAAATAGGAAGGAGCT
  • BKK10420 ([gene|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTATGGCCTCCATCCT, downstream forward: _UP4_TAGAAAAATAGGAAGGAGCT
  • Expression vectors

  • for expression, purification in E. coli with N-terminal His-tag, pRSETA available in Gerth lab
  • labs

  • [SW|Oscar Kuipers], University of Groningen, The Netherlands
  • [http://molgen.biol.rug.nl/molgen/index.php Homepage]
  • References

    Reviews

  • 19995980,12576575,26110607
  • The [SW|ComK regulon]

  • 11948146,11918817
  • Original Publications

  • 8878039,11849533,17569828,9335269,17560370,12586407,11814663,9108277,9890793,9585513,15819619,10908654,9000055,7746142,8830686,10447896,12028382,8016067,10361283,11703662,12107147,17581123,8016066,17493123,16391071,16436435,12270822,15598897,20300532,12761164,12036071,21085679,22517742,7783616,22412392,8083168,24838881,8196543,26110430,27045827,27920766,28800172,29124898,29553055