SubtiBank SubtiBank
ytbQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ytbQ

unknown
locus
BSU_30180
pI
5.15
mw
22.59 kDa
protein length
253 aa Sequence Blast
gene length
762 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,088,388 3,089,149

    The protein

    Protein family

  • [SW|NAD(P)-dependent epimerase/dehydratase family] (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|C40116089BAD3F9831F8C837DC4F2E045753ABDE|bioW]-[gene|68C86FED3575B864C576DFB73FE7B5BF83994D1F|bioA]-[gene|8B6A3E86A88928526D94FDA94B9C81ABF6E9ACFB|bioF]-[gene|D9A71DAF949FB6C9C22C8361D83C5A0741184977|bioD]-[gene|5880617EB95FC0D19219A868D6D0A3D1D0D9C532|bioB]-[gene|8FBC9A1AC108DC99E275D7A27C18C797D3CDB936|bioI]-[gene|089A32D08B5A7E552CBD9CB9745BD542863B4558|ytbQ]
    description
    [Pubmed|8763940,8892842]

    regulatory mechanism

  • [protein|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA]: repression, [Pubmed|8763940,8892842], in [regulon|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA regulon]
  • regulation

  • repressed in the presence of biotin ([protein|search|BirA]) [Pubmed|8763940,8892842]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A805 (ytbQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/805 NBRP B. subtilis, Japan]
  • BKE30180 ([gene|089A32D08B5A7E552CBD9CB9745BD542863B4558|ytbQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGATGTTCACTCCCCTTT, downstream forward: _UP4_TAATCATTTTCTAAGATTAT
  • BKK30180 ([gene|089A32D08B5A7E552CBD9CB9745BD542863B4558|ytbQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGATGTTCACTCCCCTTT, downstream forward: _UP4_TAATCATTTTCTAAGATTAT
  • References

  • 8763940,8892842