SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


hydrolysis of 5-bromo-4-chloroindolyl phosphate
23.81 kDa
protein length
204 aa Sequence Blast
gene length
615 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    35,845 36,459

    Expression and Regulation


    view in new tab


    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|22383849], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed in stationary phase
  • view in new tab

    Biological materials


  • BKE00250 ([gene|08314FA6195D553B8522BCD3B45FEE0EAB51F64D|xpaC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGATAATCGACTCCTG, downstream forward: _UP4_AAATAAGGGAAGAGGGTAAG
  • BKK00250 ([gene|08314FA6195D553B8522BCD3B45FEE0EAB51F64D|xpaC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGATAATCGACTCCTG, downstream forward: _UP4_AAATAAGGGAAGAGGGTAAG
  • References

  • 9987136,22383849