SubtiBank SubtiBank
appA/2
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

appA/2

oligopeptide ABC transporter, inactive pseudogene in strain 168
locus
BSU_11382
pI
0.00
mw
0.00 kDa
protein length
388 aa Sequence Blast
gene length
1167 bp Sequence Blast
function
unknown
product
oligopeptide ABC transporter
essential
no
synonyms
Outlinks

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.3|Uptake of peptides]
  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    Coordinates
    1,214,001 1,215,167

    The protein

    Protein family

  • [SW|bacterial solute-binding protein 5 family] (according to UniProt)
  • Structure

  • [PDB|1XOC] (the intact protein) [pubmed|15588833]
  • Expression and Regulation

    Operons

    genes
    [gene|325BCDCAB4003204294229B7F9F0A5F353D72B54|appD]-[gene|B88A88B4792FFFF4E1609B1FC91AAE6DBA339044|appF]-[gene|DD2C5F549759447FF1C30E5B43BCB74CE4320EF3|appA/1]-[gene|082D2012ABE3671F62211F77ED501849BF77B4EF|appA/2]-[gene|C6EB94EACDA544700A468545BD1FDA91C5FD82FB|appB]-[gene|252E3F0A05D78CEC46A08B46D1C6133239B6B8BA|appC]
    description
    [Pubmed|7997159]

    regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|25755103], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [pubmed|12618455] [pubmed|18083814], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|10383984], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • regulation

  • repressed by [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY] [Pubmed|12618455]
  • view in new tab

    Biological materials

    Mutant

  • GP2100 (D(''[gene|325BCDCAB4003204294229B7F9F0A5F353D72B54|appD]-[gene|B88A88B4792FFFF4E1609B1FC91AAE6DBA339044|appF]-[gene|082D2012ABE3671F62211F77ED501849BF77B4EF|appA/2]-[gene|C6EB94EACDA544700A468545BD1FDA91C5FD82FB|appB]-[gene|252E3F0A05D78CEC46A08B46D1C6133239B6B8BA|appC]'')::''spc''), available in [SW|Jörg Stülke]'s lab
  • BKE11382 ([gene|082D2012ABE3671F62211F77ED501849BF77B4EF|appA/2]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11382 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCCTTTTTTTCTACGGATTT, downstream forward: _UP4_TAAATTTCCCTTAAAGGGGA
  • BKK11382 ([gene|082D2012ABE3671F62211F77ED501849BF77B4EF|appA/2]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11382 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCCTTTTTTTCTACGGATTT, downstream forward: _UP4_TAAATTTCCCTTAAAGGGGA