SubtiBank SubtiBank
appA/2
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

appA/2

oligopeptide ABC transporter, inactive pseudogene in strain 168
locus
BSU_11382
pI
0.00
mw
0.00 kDa
protein length
388 aa Sequence Blast
gene length
1167 bp Sequence Blast
function
unknown
product
oligopeptide ABC transporter
essential
no
synonyms
Outlinks

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.3|Uptake of peptides]
  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    Coordinates
    1,214,001 1,215,167

    The protein

    Protein family

  • [SW|bacterial solute-binding protein 5 family] (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|325BCDCAB4003204294229B7F9F0A5F353D72B54|appD]-[gene|B88A88B4792FFFF4E1609B1FC91AAE6DBA339044|appF]-[gene|DD2C5F549759447FF1C30E5B43BCB74CE4320EF3|appA/1]-[gene|082D2012ABE3671F62211F77ED501849BF77B4EF|appA/2]-[gene|C6EB94EACDA544700A468545BD1FDA91C5FD82FB|appB]-[gene|252E3F0A05D78CEC46A08B46D1C6133239B6B8BA|appC]
    description
    [Pubmed|7997159]

    regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|25755103], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [pubmed|12618455] [pubmed|18083814], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|10383984], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • regulation

  • repressed by [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY] [Pubmed|12618455]
  • view in new tab

    Biological materials

    Mutant

  • GP2100 (D(''[gene|325BCDCAB4003204294229B7F9F0A5F353D72B54|appD]-[gene|B88A88B4792FFFF4E1609B1FC91AAE6DBA339044|appF]-[gene|082D2012ABE3671F62211F77ED501849BF77B4EF|appA/2]-[gene|C6EB94EACDA544700A468545BD1FDA91C5FD82FB|appB]-[gene|252E3F0A05D78CEC46A08B46D1C6133239B6B8BA|appC]'')::''spc''), available in [SW|Jörg Stülke]'s lab
  • BKE11382 ([gene|082D2012ABE3671F62211F77ED501849BF77B4EF|appA/2]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11382 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCCTTTTTTTCTACGGATTT, downstream forward: _UP4_TAAATTTCCCTTAAAGGGGA
  • BKK11382 ([gene|082D2012ABE3671F62211F77ED501849BF77B4EF|appA/2]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11382 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCCTTTTTTTCTACGGATTT, downstream forward: _UP4_TAAATTTCCCTTAAAGGGGA