SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


oligopeptide ABC transporter, inactive pseudogene in strain 168
0.00 kDa
protein length
388 aa Sequence Blast
gene length
1167 bp Sequence Blast
oligopeptide ABC transporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of peptides]
  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    1,214,001 1,215,167

    Expression and Regulation



    regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|25755103], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [pubmed|12618455] [pubmed|18083814], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|10383984], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • regulation

  • repressed by [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY] [Pubmed|12618455]
  • view in new tab

    Biological materials


  • GP2100 (D(''[gene|325BCDCAB4003204294229B7F9F0A5F353D72B54|appD]-[gene|B88A88B4792FFFF4E1609B1FC91AAE6DBA339044|appF]-[gene|082D2012ABE3671F62211F77ED501849BF77B4EF|appA/2]-[gene|C6EB94EACDA544700A468545BD1FDA91C5FD82FB|appB]-[gene|252E3F0A05D78CEC46A08B46D1C6133239B6B8BA|appC]'')::''spc''), available in [SW|Jörg Stülke]'s lab
  • BKE11382 ([gene|082D2012ABE3671F62211F77ED501849BF77B4EF|appA/2]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCCTTTTTTTCTACGGATTT, downstream forward: _UP4_TAAATTTCCCTTAAAGGGGA
  • BKK11382 ([gene|082D2012ABE3671F62211F77ED501849BF77B4EF|appA/2]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCCTTTTTTTCTACGGATTT, downstream forward: _UP4_TAAATTTCCCTTAAAGGGGA