SubtiBank SubtiBank
yxeC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yxeC

unknown
locus
BSU_39600
pI
10.10
mw
15.54 kDa
protein length
132 aa Sequence Blast
gene length
399 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    4,066,607 4,067,005

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|08277404EB118F316CF42BD9FED883ADA098AA42|yxeC]
    description
    [Pubmed|10746760]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B776 (yxeC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1775 NBRP B. subtilis, Japan]
  • BKE39600 (''[gene|08277404EB118F316CF42BD9FED883ADA098AA42|yxeC]''::''erm'', available in the BGSC, in [SW|Fabian Commichau]'s, and in [SW|Jörg Stülke]'s labs) [pubmed|28189581]
  • BKE39600 ([gene|08277404EB118F316CF42BD9FED883ADA098AA42|yxeC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTTTCTCCTCCTATT, downstream forward: _UP4_TAAGAAAAAAAGCTCAACAC
  • BKK39600 ([gene|08277404EB118F316CF42BD9FED883ADA098AA42|yxeC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTTTCTCCTCCTATT, downstream forward: _UP4_TAAGAAAAAAAGCTCAACAC
  • References

  • 10746760