SubtiBank SubtiBank
sigM
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

sigM

RNA polymerase ECF-type sigma factor SigM, required for adaptation to inhibitors of peptidoglycan synthesis
locus
BSU09520
pI
6.77
mw
19.26 kDa
protein length
163 aa Sequence Blast
gene length
489 bp Sequence Blast
function
adaptation to inhibitors of peptidoglycan synthesis
product
RNA polymerase ECF-type sigma factor SigM
essential
no
synonyms
yhdM

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW 3.2.1.2|Sigma factors]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.1|Sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    1,029,577 → 1,030,068

    Phenotypes of a mutant

  • SigM is essential for growth and survival in nutrient broth (NB) containing 1.4 M NaCl [Pubmed|10216858]
  • ''sigM'' mutants form aberrantly shaped cells, which swell and lyse spontaneously during growth in NB medium containing increased levels (0.35-0.7 M) of a wide range of different salts [Pubmed|10216858]
  • increased sensitivity towards beta-lactam antibiotics [Pubmed|22211522]
  • a ''[gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM] [gene|0AFFB4B715CCE6B1C53BBB7F890EFB3126CB466E|murJ]'' double mutant is not viable (due to the lack of both lipid II flippases) [Pubmed|25918422]
  • The protein

    Protein family

  • sigma-70 factor family, ECF subfamily (according to Swiss-Prot)
  • Effectors of protein activity

  • expression of [protein|824E6AE2FFA3CBC9F90648F15178A00A6CC49E4C|CsbB] in the absence of [protein|BDFB6CCB5AAD9747971DE6B78E07558706E04617|YfhO] causes constitutive activation of [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM] [Pubmed|23632331]
  • shortage of available bactoprenol causes [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM] activation [Pubmed|23632331]
  • Structure

  • [PDB|5WUQ] ([protein|search|SigW ]in complex with the cytoplasmic domain of [protein|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|RsiW], 32% identity) [pubmed|28319136]
  • Additional information

  • Expression of the [SW|SigM regulon] in increased in ''[gene|7A606B8E952AE8CA4F9A62008BA4B156725BB5B5|ugtP]'' mutants [Pubmed|22362028]
  • Expression and Regulation

    Operons

    genes
    [gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]-[gene|48975EC8FB5B03F136AA112DE2ED9CFD0E9C4141|yhdL]-[gene|43AD66E4AEE951130F134FD720E17DB4D2FF112E|yhdK]
    description
    [Pubmed|9573210]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9573210], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|9573210,18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • regulation

  • induced by glucose [Pubmed|27965645]
  • additional information

  • expression of [protein|search|CsbB] in the absence of [protein|search|YfhO] causes constitutive activation of [protein|search|SigM] [PubMed|23632331]
  • view in new tab

    Biological materials

    Mutant

  • 1A906 (''sigM''::''kan''), [Pubmed|12207695], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A906&Search=1A906 BGSC]
  • BP129 (''sigM::aphA3''), available in [SW|Fabian Commichau]'s lab
  • BKE09520 (Δ[gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGCCTTTTCTCCCCTCT, downstream forward: _UP4_AAAGCACTTTATAATAGAGG
  • BKK09520 (Δ[gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGCCTTTTCTCCCCTCT, downstream forward: _UP4_AAAGCACTTTATAATAGAGG
  • Labs working on this gene/protein

  • [SW|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]
  • References

    Reviews

  • 24921931,26901131,27344142
  • The [SW|SigM regulon]

  • 18179421,17675383,17434969
  • Other original publications

  • 22362028,18394148,14993308,12399481,12775685,12207695,18820022,15838020,19047346,14651641,16151214,19465659,19745567,10216858,20057163,23103977,23632331,23070162,22211522,20817771,25918422,26399770,27965645,28319136