SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


[SW|RNA polymerase] ECF-type [SW|sigma factor] [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM], required for adaptation to inhibitors of peptidoglycan synthesis
19.26 kDa
protein length
163 aa Sequence Blast
gene length
492 bp Sequence Blast
adaptation to inhibitors of peptidoglycan synthesis
[SW|RNA polymerase] ECF-type [SW|sigma factor] [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW|Sigma factors]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    1,029,577 1,030,068

    Phenotypes of a mutant

  • SigM is essential for growth and survival in nutrient broth (NB) containing 1.4 M NaCl [Pubmed|10216858]
  • ''sigM'' mutants form aberrantly shaped cells, which swell and lyse spontaneously during growth in NB medium containing increased levels (0.35-0.7 M) of a wide range of different salts [Pubmed|10216858]
  • increased sensitivity towards beta-lactam antibiotics [Pubmed|22211522]
  • a ''[gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM] [gene|0AFFB4B715CCE6B1C53BBB7F890EFB3126CB466E|murJ]'' double mutant is not viable (due to the lack of both lipid II flippases) [Pubmed|25918422]
  • The protein

    Protein family

  • [SW|Sigma-70 factor family] (according to UniProt)
  • [SW|ECF subfamily] (according to UniProt)
  • Effectors of protein activity

  • expression of [protein|824E6AE2FFA3CBC9F90648F15178A00A6CC49E4C|CsbB] in the absence of [protein|BDFB6CCB5AAD9747971DE6B78E07558706E04617|YfhO] causes constitutive activation of [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM] [Pubmed|23632331]
  • shortage of available bactoprenol causes [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM] activation [Pubmed|23632331]
  • Structure

  • [PDB|5WUQ] ([protein|search|SigW ]in complex with the cytoplasmic domain of [protein|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|RsiW], 32% identity) [pubmed|28319136]
  • Additional information

  • Expression of the [SW|SigM regulon] in increased in ''[gene|7A606B8E952AE8CA4F9A62008BA4B156725BB5B5|ugtP]'' mutants [Pubmed|22362028]
  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9573210], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|9573210,18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • regulation

  • induced by glucose [Pubmed|27965645]
  • additional information

  • expression of [protein|search|CsbB] in the absence of [protein|search|YfhO] causes constitutive activation of [protein|search|SigM] [PubMed|23632331]
  • view in new tab

    Biological materials


  • 1A906 (''sigM''::''kan''), [Pubmed|12207695], available at [ BGSC]
  • BP97 (Δ([gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]-[gene|48975EC8FB5B03F136AA112DE2ED9CFD0E9C4141|yhdL]-[gene|43AD66E4AEE951130F134FD720E17DB4D2FF112E|yhdK])::aphA3), available in [SW|Fabian Commichau]'s lab
  • BP129 (Δ''sigM::aphA3''), available in [SW|Fabian Commichau]'s lab
  • BKE09520 ([gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGCCTTTTCTCCCCTCT, downstream forward: _UP4_AAAGCACTTTATAATAGAGG
  • BKK09520 ([gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGCCTTTTCTCCCCTCT, downstream forward: _UP4_AAAGCACTTTATAATAGAGG
  • labs

  • [SW|John Helmann], Cornell University, USA [ Homepage]
  • References


  • 24921931,26901131,27344142,29343670
  • The [SW|SigM regulon]

  • 18179421,17675383,17434969
  • Other original publications

  • 22362028,18394148,14993308,12399481,12775685,12207695,18820022,15838020,19047346,14651641,16151214,19465659,19745567,10216858,20057163,23103977,23632331,23070162,22211522,20817771,25918422,26399770,27965645,28319136,30715747,31626625,33114184