SubtiBank SubtiBank
yisK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yisK

modulator of [protein|6ED386D49F973C1F6B1076974F54275DD583C9D3|Mbl] activity, similar to 5-oxo-1,2,5-tricarboxilic-3-penten acid decarboxylase
locus
BSU10750
pI
5.45
mw
32.99 kDa
protein length
301 aa Sequence Blast
gene length
906 bp Sequence Blast
function
control of [SW|cell division]
product
modulator of [protein|6ED386D49F973C1F6B1076974F54275DD583C9D3|Mbl] activity
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.8|Cell division] → [category|SW 1.1.8.2|Other genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,152,244 1,153,149

    Phenotypes of a mutant

  • overexpression results in loss of cell width and cell lysis (suppressed by mutations in [protein|6ED386D49F973C1F6B1076974F54275DD583C9D3|Mbl] that affect the ATP-binding site) [Pubmed|27215790]
  • The protein

    Structure

  • [PDB|3R60] (from ''Mycobacterium Abscessus'', 42% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|07E876715DCF551B8BDB6AA5D33C700696B4E730|yisK]-[gene|BDA8B49AC4AE81383D84337C7FEE9D88EA92AED3|yisL]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|27215790], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|27215790], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B291 (yisK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1290 NBRP B. subtilis, Japan]
  • BKE10750 ([gene|07E876715DCF551B8BDB6AA5D33C700696B4E730|yisK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTATTCCTCCATCATC, downstream forward: _UP4_TGAATAAAACTGGAGGGCGG
  • BKK10750 ([gene|07E876715DCF551B8BDB6AA5D33C700696B4E730|yisK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTATTCCTCCATCATC, downstream forward: _UP4_TGAATAAAACTGGAGGGCGG
  • References

  • 27215790