SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


22.94 kDa
protein length
206 aa Sequence Blast
gene length
621 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    2,808,707 2,809,327

    The protein


  • contains six [SW|TPR repeat|tetratrichopeptide repeats] (according to UniProt)[Pubmed|17624311]
  • Structure

  • [PDB|2Q7F] [Pubmed|17624311]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A859 (yrrB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE27490 ([gene|07DFF7D7BE1BACFB148F600400BDE5933BF1DD07|yrrB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGCCTCTATACCGAGTT, downstream forward: _UP4_TAACAGGCACAGGAGGAGGG
  • BKK27490 ([gene|07DFF7D7BE1BACFB148F600400BDE5933BF1DD07|yrrB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGCCTCTATACCGAGTT, downstream forward: _UP4_TAACAGGCACAGGAGGAGGG
  • References

  • 17624311