SubtiBank SubtiBank
yrrB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yrrB

unknown
locus
BSU_27490
pI
4.33
mw
22.94 kDa
protein length
206 aa Sequence Blast
gene length
621 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,808,707 2,809,327

    The protein

    [SW|Domains]

  • contains six [SW|TPR repeat|tetratrichopeptide repeats] (according to UniProt)[Pubmed|17624311]
  • Structure

  • [PDB|2Q7F] [Pubmed|17624311]
  • Expression and Regulation

    Operons

    genes
    [gene|50930C56C27D22715620A350220E3C56ADB41020|cymR]-[gene|4F5945C3C8F18BD1B30D97CD516A06077C200B9D|yrvO]-[gene|2F5DFBE980FFF5810B76BCFCD189BA0F6C415B4F|trmU]-[gene|07DFF7D7BE1BACFB148F600400BDE5933BF1DD07|yrrB]-[gene|A3D05FE662CCCFE79B3CB38486206413B84E5D80|recD2]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A859 (yrrB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/859 NBRP B. subtilis, Japan]
  • BKE27490 ([gene|07DFF7D7BE1BACFB148F600400BDE5933BF1DD07|yrrB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGCCTCTATACCGAGTT, downstream forward: _UP4_TAACAGGCACAGGAGGAGGG
  • BKK27490 ([gene|07DFF7D7BE1BACFB148F600400BDE5933BF1DD07|yrrB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGCCTCTATACCGAGTT, downstream forward: _UP4_TAACAGGCACAGGAGGAGGG
  • References

  • 17624311