SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


15.22 kDa
protein length
136 aa Sequence Blast
gene length
411 bp Sequence Blast
control of Sig([protein|6359025A73C0BD313F5BCC6F56FE88B820902AAA|SigO]-[protein|AE8D4F07EFB17DA727D80229C3E72075928AA352|RsoA]) activity

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.3|Acid stress proteins (controlled by YvrI-YvrHa)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,411,684 3,412,094

    The protein


  • cell membrane [Pubmed|26651345]
  • Expression and Regulation



    sigma factors

  • [protein|6359025A73C0BD313F5BCC6F56FE88B820902AAA|SigO]: sigma factor, [Pubmed|19047353], in [regulon|6359025A73C0BD313F5BCC6F56FE88B820902AAA|SigO regulon]
  • [protein|AE8D4F07EFB17DA727D80229C3E72075928AA352|RsoA]: sigma factor, in [regulon|AE8D4F07EFB17DA727D80229C3E72075928AA352|RsoA regulon]
  • regulation

  • induced by acidic growth conditions [Pubmed|19047353]
  • view in new tab

    Biological materials


  • MGNA-B054 (yvrL::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33250 ([gene|07C35D58F6AF97F8E6BB75CF8E8B811BAFAB201B|rsiO]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGGTTCAGCTCCTTATG, downstream forward: _UP4_TAAAAAAAGAACGCATTCCA
  • BKK33250 ([gene|07C35D58F6AF97F8E6BB75CF8E8B811BAFAB201B|rsiO]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGGTTCAGCTCCTTATG, downstream forward: _UP4_TAAAAAAAGAACGCATTCCA
  • labs

  • [SW|John Helmann], Cornell University, USA [ Homepage]
  • References

  • 18573182,19047353,26651345