SubtiBank SubtiBank
yitT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yitT

general stress protein, required for protection against paraquat stress
locus
BSU_11120
pI
9.50
mw
30.38 kDa
protein length
280 aa Sequence Blast
gene length
843 bp Sequence Blast
function
protection against paraquat stress
product
unknown
essential
no
synonyms
yuxA

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,188,689 1,189,531

    The protein

    Protein family

  • [SW|UPF0750 membrane proteins] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|07ABC6A548F1186B67B58C0E14915AC3FE94882E|yitT]-[gene|D5536B27AFF8ADE7FAEA9B815F2607FC33B66404|ipi]
    description
    [Pubmed|27965289]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B209 (yitT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1208 NBRP B. subtilis, Japan]
  • BKE11120 ([gene|07ABC6A548F1186B67B58C0E14915AC3FE94882E|yitT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCATGTTCCTCCGCTC, downstream forward: _UP4_TGACGAAAGCAGGTGGAAGT
  • BKK11120 ([gene|07ABC6A548F1186B67B58C0E14915AC3FE94882E|yitT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCATGTTCCTCCGCTC, downstream forward: _UP4_TGACGAAAGCAGGTGGAAGT
  • References

  • 15805528,22582280,27965289