SubtiBank SubtiBank
ykrP
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ykrP

putative membrane-bound acyltransferase
locus
BSU_13520
pI
9.99
mw
39.25 kDa
protein length
340 aa Sequence Blast
gene length
1023 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,417,938 1,418,960

    The protein

    Protein family

  • Acyltransferase 3 family (with [protein|A408883503931320B1BC04F38E6D475530518A25|YfiQ] and [protein|E97C7A219DB059BB634E893CC355A28324C87ADB|OatA],according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|07A53089107037359C428549FF877638B90CF074|ykrP]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B318 (ykrP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1317 NBRP B. subtilis, Japan]
  • BKE13520 ([gene|07A53089107037359C428549FF877638B90CF074|ykrP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCATCACCTTCTCTTT, downstream forward: _UP4_TAGAAAAAGCACCTCTTAAG
  • BKK13520 ([gene|07A53089107037359C428549FF877638B90CF074|ykrP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCATCACCTTCTCTTT, downstream forward: _UP4_TAGAAAAAGCACCTCTTAAG