SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


protein N-acetyltransferase, may acetylate [protein|EFD8FC875B6787B1512C5FC4C81E7E4C9BD93028|HBsu]
18.23 kDa
protein length
157 aa Sequence Blast
gene length
474 bp Sequence Blast

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein acetylases/ deacetylases]
  • Gene

    604,103 604,576

    The protein

    Catalyzed reaction/ biological activity

  • may acetylate [protein|EFD8FC875B6787B1512C5FC4C81E7E4C9BD93028|HBsu] on Lys-41 and Lys-86 [pubmed|30808761]
  • Protein family

  • [SW|Acetyltransferase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|A1B9CF581D2D73AC3D2E290E6B86AD63BE0544DE|YycN]
  • [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 3-157) (according to UniProt)
  • Modification

  • can self-acetylate [pubmed|30808761]
  • Structure

  • [PDB|1UFH] ([protein|A1B9CF581D2D73AC3D2E290E6B86AD63BE0544DE|YycN], 42% identity) [pubmed|14635137]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C158 (ydgE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE05600 ([gene|07A30814F57112196051289AA309AE6DB22CAEFF|ydgE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTGTATTCCTCCTTTA, downstream forward: _UP4_TGAAAAGCCGCTTACGTTAC
  • BKK05600 ([gene|07A30814F57112196051289AA309AE6DB22CAEFF|ydgE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTGTATTCCTCCTTTA, downstream forward: _UP4_TGAAAAGCCGCTTACGTTAC
  • References

    Research papers

  • 14635137,30808761