SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


putative peroxiredoxin
16.13 kDa
protein length
150 aa Sequence Blast
gene length
453 bp Sequence Blast
protection against oxidative stress
putative peroxiredoxin

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    1,864,225 1,864,677

    Phenotypes of a mutant

  • strongly increased the sensitivity of the cells to H2O2 [Pubmed|25649915]
  • The protein

    Protein family

  • osmC/ohr family (with [protein|C36DD4B670D803C5700428F62E6CA7ED127E4B41|OhrB] and [protein|869E46AECF6249610F8541E403D834284B62171D|OhrA], according to UniProt)
  • Structure

  • [PDB|3I07] (from Vibrio cholerae, 25% identity)
  • Expression and Regulation


    view in new tab

    view in new tab

    Biological materials


  • GP3166 [gene|0785B4C70C3DD00EFB8BCDD91EF4F98EF4372186|ymaD]::mls trpC2 available in [SW|Jörg Stülke]'s lab
  • MGNA-B069 (ymaD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE17280 ([gene|0785B4C70C3DD00EFB8BCDD91EF4F98EF4372186|ymaD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTTTGCCTCCTTTTT, downstream forward: _UP4_GGTGGAGAATAAAGAAAACA
  • BKK17280 ([gene|0785B4C70C3DD00EFB8BCDD91EF4F98EF4372186|ymaD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTTTGCCTCCTTTTT, downstream forward: _UP4_GGTGGAGAATAAAGAAAACA
  • References

  • 22383849,25649915