SubtiBank SubtiBank
ymaD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ymaD

putative peroxiredoxin
locus
BSU_17280
pI
5.20
mw
16.13 kDa
protein length
150 aa Sequence Blast
gene length
453 bp Sequence Blast
function
protection against oxidative stress
product
putative peroxiredoxin
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    1,864,225 1,864,677

    Phenotypes of a mutant

  • strongly increased the sensitivity of the cells to H2O2 [Pubmed|25649915]
  • The protein

    Protein family

  • osmC/ohr family (with [protein|C36DD4B670D803C5700428F62E6CA7ED127E4B41|OhrB] and [protein|869E46AECF6249610F8541E403D834284B62171D|OhrA], according to UniProt)
  • Structure

  • [PDB|3I07] (from Vibrio cholerae, 25% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|0785B4C70C3DD00EFB8BCDD91EF4F98EF4372186|ymaD]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|DF95DED9A6E2160C151D7664C951B198EEA225E8|pghC]-[gene|0785B4C70C3DD00EFB8BCDD91EF4F98EF4372186|ymaD]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • GP3166 [gene|0785B4C70C3DD00EFB8BCDD91EF4F98EF4372186|ymaD]::mls trpC2 available in [SW|Jörg Stülke]'s lab
  • MGNA-B069 (ymaD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1068 NBRP B. subtilis, Japan]
  • BKE17280 ([gene|0785B4C70C3DD00EFB8BCDD91EF4F98EF4372186|ymaD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTTTGCCTCCTTTTT, downstream forward: _UP4_GGTGGAGAATAAAGAAAACA
  • BKK17280 ([gene|0785B4C70C3DD00EFB8BCDD91EF4F98EF4372186|ymaD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTTTGCCTCCTTTTT, downstream forward: _UP4_GGTGGAGAATAAAGAAAACA
  • References

  • 22383849,25649915