SubtiBank SubtiBank
csgA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

csgA

required for the ability of the germinating spore to resume vegetative growth
locus
BSU02070
pI
4.69
mw
9.70 kDa
protein length
gene length
249 bp Sequence Blast
function
spore germination
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.2|Additional germination proteins]
  • Gene

    Coordinates
    228,066 228,314

    Expression and Regulation

    Operons

    genes
    [gene|07813844C05DB8670B810251979782094D184549|csgA]-[gene|5C81DD256BDEE777EE67566D3061131CFFAEAF21|ybxH]
    description
    [Pubmed|9016963]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,9016963], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: repression, in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • regulation

  • expressed during sporulation in the forespore ([SW|SpoVT]) [Pubmed|9016963]
  • view in new tab

    Biological materials

    Mutant

  • BKE02070 ([gene|07813844C05DB8670B810251979782094D184549|csgA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTATGAACACCTTTCC, downstream forward: _UP4_CTGCTTTGAGAAAGGCGGGT
  • BKK02070 ([gene|07813844C05DB8670B810251979782094D184549|csgA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTATGAACACCTTTCC, downstream forward: _UP4_CTGCTTTGAGAAAGGCGGGT
  • References

  • 9016963,15699190