SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


required for the ability of the germinating spore to resume vegetative growth
9.70 kDa
protein length
gene length
249 bp Sequence Blast
spore germination

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW|Additional germination proteins]
  • Gene

    228,066 228,314

    Expression and Regulation



    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,9016963], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: repression, in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • regulation

  • expressed during sporulation in the forespore ([SW|SpoVT]) [Pubmed|9016963]
  • view in new tab

    Biological materials


  • BKE02070 ([gene|07813844C05DB8670B810251979782094D184549|csgA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTATGAACACCTTTCC, downstream forward: _UP4_CTGCTTTGAGAAAGGCGGGT
  • BKK02070 ([gene|07813844C05DB8670B810251979782094D184549|csgA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTATGAACACCTTTCC, downstream forward: _UP4_CTGCTTTGAGAAAGGCGGGT
  • References

  • 9016963,15699190