SubtiBank SubtiBank
ywiE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywiE

minor cardiolipin synthetase, general stress protein, required for protection against paraquat stress
locus
BSU_37240
pI
8.38
mw
58.08 kDa
protein length
500 aa Sequence Blast
gene length
1503 bp Sequence Blast
function
phospholipiid biosynthesis, protection against paraquat stress
product
minor cardiolipin synthetase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW 2.4.2.2|Biosynthesis of phospholipids]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,821,570 3,823,072

    The protein

    Catalyzed reaction/ biological activity

  • 2 1,2-diacyl-sn-glycero-3-phospho-(1'-sn-glycerol) --> cardiolipin + glycerol (according to UniProt)
  • Protein family

  • phospholipase D family (with [protein|B63AAF0D3277FD776944A09D2546F3E48C8716AD|YwjE] and [protein|2079B210322F26EEC3CCF55611622FADDB1D1BC7|ClsA], according to UniProt)
  • Paralogous protein(s)

  • [protein|2079B210322F26EEC3CCF55611622FADDB1D1BC7|ClsA], [protein|B63AAF0D3277FD776944A09D2546F3E48C8716AD|YwjE]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|07752EC6940F43DEBD1E9313A2A195E35EDB9F69|ywiE]-[gene|D5A3C316BD4567A0155F70330E32ACDE18F063FE|ywjA]-[gene|685B58AD2A02A0B48B7D4AAAE046DE2CF8F77C58|ywjB]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A553 (ywiE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/553 NBRP B. subtilis, Japan]
  • BKE37240 ([gene|07752EC6940F43DEBD1E9313A2A195E35EDB9F69|ywiE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTGATTCTCTCCAATC, downstream forward: _UP4_TAAGAAAAAAGAAATCTGAT
  • BKK37240 ([gene|07752EC6940F43DEBD1E9313A2A195E35EDB9F69|ywiE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTGATTCTCTCCAATC, downstream forward: _UP4_TAAGAAAAAAGAAATCTGAT
  • References

  • 14973018,15805528,22582280,16514141