SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


minor cardiolipin synthetase, general stress protein, required for protection against paraquat stress
58.08 kDa
protein length
500 aa Sequence Blast
gene length
1503 bp Sequence Blast
phospholipiid biosynthesis, protection against paraquat stress
minor cardiolipin synthetase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW|Biosynthesis of phospholipids]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,821,570 3,823,072

    The protein

    Catalyzed reaction/ biological activity

  • 2 Phosphatidylglycerol = diphosphatidylglycerol + glycerol (according to Swiss-Prot)
  • Protein family

  • Cardiolipin synthase subfamily (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|2079B210322F26EEC3CCF55611622FADDB1D1BC7|ClsA], [protein|B63AAF0D3277FD776944A09D2546F3E48C8716AD|YwjE]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • view in new tab

    Biological materials


  • MGNA-A553 (ywiE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE37240 ([gene|07752EC6940F43DEBD1E9313A2A195E35EDB9F69|ywiE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTGATTCTCTCCAATC, downstream forward: _UP4_TAAGAAAAAAGAAATCTGAT
  • BKK37240 ([gene|07752EC6940F43DEBD1E9313A2A195E35EDB9F69|ywiE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTGATTCTCTCCAATC, downstream forward: _UP4_TAAGAAAAAAGAAATCTGAT
  • References

  • 14973018,15805528,22582280,16514141