SubtiBank SubtiBank
yuiF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yuiF

membrane protein
locus
BSU_32040
pI
5.93
mw
45.77 kDa
protein length
442 aa Sequence Blast
gene length
1329 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,294,942 3,296,270

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|076343A6A45A51434D3CF9C938800B2CE7898045|yuiF]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B568 (yuiF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1567 NBRP B. subtilis, Japan]
  • BKE32040 ([gene|076343A6A45A51434D3CF9C938800B2CE7898045|yuiF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGATACCCCTCCAAA, downstream forward: _UP4_TAGGAAAAAGGCTCCCCTTT
  • BKK32040 ([gene|076343A6A45A51434D3CF9C938800B2CE7898045|yuiF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGATACCCCTCCAAA, downstream forward: _UP4_TAGGAAAAAGGCTCCCCTTT
  • References

  • 18763711