SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


membrane protein
45.77 kDa
protein length
442 aa Sequence Blast
gene length
1329 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    3,294,942 3,296,270

    The protein


  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B568 (yuiF::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32040 ([gene|076343A6A45A51434D3CF9C938800B2CE7898045|yuiF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGATACCCCTCCAAA, downstream forward: _UP4_TAGGAAAAAGGCTCCCCTTT
  • BKK32040 ([gene|076343A6A45A51434D3CF9C938800B2CE7898045|yuiF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGATACCCCTCCAAA, downstream forward: _UP4_TAGGAAAAAGGCTCCCCTTT
  • References

  • 18763711