SubtiBank SubtiBank
csbC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

csbC

general stress protein, similar to sugar-H+ symporter, required for protection against paraquat stress
locus
BSU39810
pI
9.94
mw
49.97 kDa
protein length
461 aa Sequence Blast
gene length
1386 bp Sequence Blast
function
protection against paraquat stress
product
putative sugar-H+ symporter
essential
no
synonyms
yxcC

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    4,088,002 4,089,387

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|0757FAEB38AA1C599C5067794AF83A4BA5912DC9|CsbC], [protein|4A77316AA94F9C11DB70AB76711AACBD28098AA1|IolT], [protein|770D9A5BEEEABE9C3FC772E74001329206ECFAB3|AraE], [protein|7CE5A42042E5D52768735E795DB805530691D8A6|YwtG], [protein|8B0701B5694ABA8142476CB896E590FE1981D7DB|YfiG], [protein|A84AC4E40E7C722E27AE9C24ACECFEABD51B57BE|YncC], [protein|0757FAEB38AA1C599C5067794AF83A4BA5912DC9|CsbC]
  • [SW|Domains]

  • contains 12 trans-membrane domains [Pubmed|23180473]
  • Structure

  • [PDB|4LDS] (from Staphylococcus epidermidis, 54% identity) [pubmed|24127585]
  • [SW|Localization]

  • homogeneously distributed in the cell membrane [Pubmed|23180473]
  • Expression and Regulation

    Operons

    genes
    [gene|0757FAEB38AA1C599C5067794AF83A4BA5912DC9|csbC]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([gene|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B695 (yxcC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1694 NBRP B. subtilis, Japan]
  • BKE39810 ([gene|0757FAEB38AA1C599C5067794AF83A4BA5912DC9|csbC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAATGTCTCCTCCTCAG, downstream forward: _UP4_TAAAAAAAGGAATCGTCTCC
  • BKK39810 ([gene|0757FAEB38AA1C599C5067794AF83A4BA5912DC9|csbC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAATGTCTCCTCCTCAG, downstream forward: _UP4_TAAAAAAAGGAATCGTCTCC
  • References

  • 10376822,21630458,15805528,23180473,22582280,24127585