SubtiBank SubtiBank
csbC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

csbC

general stress protein, similar to sugar-H+ symporter, required for protection against paraquat stress
locus
BSU_39810
pI
9.94
mw
49.97 kDa
protein length
461 aa Sequence Blast
gene length
1386 bp Sequence Blast
function
protection against paraquat stress
product
putative sugar-H+ symporter
essential
no
synonyms
yxcC

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    4,088,002 4,089,387

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Sugar transporter (TC 2.A.1.1) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|0757FAEB38AA1C599C5067794AF83A4BA5912DC9|CsbC], [protein|4A77316AA94F9C11DB70AB76711AACBD28098AA1|IolT], [protein|770D9A5BEEEABE9C3FC772E74001329206ECFAB3|AraE], [protein|7CE5A42042E5D52768735E795DB805530691D8A6|YwtG], [protein|8B0701B5694ABA8142476CB896E590FE1981D7DB|YfiG], [protein|A84AC4E40E7C722E27AE9C24ACECFEABD51B57BE|YncC], [protein|0757FAEB38AA1C599C5067794AF83A4BA5912DC9|CsbC]
  • [SW|Domains]

  • contains 12 trans-membrane domains [Pubmed|23180473]
  • Structure

  • [PDB|4LDS] (from Staphylococcus epidermidis, 54% identity) [pubmed|24127585]
  • [SW|Localization]

  • homogeneously distributed in the cell membrane [Pubmed|23180473]
  • Expression and Regulation

    Operons

    genes
    [gene|0757FAEB38AA1C599C5067794AF83A4BA5912DC9|csbC]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([gene|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B695 (yxcC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1694 NBRP B. subtilis, Japan]
  • BKE39810 ([gene|0757FAEB38AA1C599C5067794AF83A4BA5912DC9|csbC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAATGTCTCCTCCTCAG, downstream forward: _UP4_TAAAAAAAGGAATCGTCTCC
  • BKK39810 ([gene|0757FAEB38AA1C599C5067794AF83A4BA5912DC9|csbC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAATGTCTCCTCCTCAG, downstream forward: _UP4_TAAAAAAAGGAATCGTCTCC
  • References

  • 10376822,21630458,15805528,23180473,22582280,24127585