SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


general stress protein, similar to sugar-H+ symporter, required for protection against paraquat stress
49.97 kDa
protein length
461 aa Sequence Blast
gene length
1386 bp Sequence Blast
protection against paraquat stress
putative sugar-H+ symporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Other transporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    4,088,002 4,089,387

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Sugar transporter (TC 2.A.1.1) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|0757FAEB38AA1C599C5067794AF83A4BA5912DC9|CsbC], [protein|4A77316AA94F9C11DB70AB76711AACBD28098AA1|IolT], [protein|770D9A5BEEEABE9C3FC772E74001329206ECFAB3|AraE], [protein|7CE5A42042E5D52768735E795DB805530691D8A6|YwtG], [protein|8B0701B5694ABA8142476CB896E590FE1981D7DB|YfiG], [protein|A84AC4E40E7C722E27AE9C24ACECFEABD51B57BE|YncC], [protein|0757FAEB38AA1C599C5067794AF83A4BA5912DC9|CsbC]
  • [SW|Domains]

  • contains 12 trans-membrane domains [Pubmed|23180473]
  • Structure

  • [PDB|4LDS] (from Staphylococcus epidermidis, 54% identity) [pubmed|24127585]
  • [SW|Localization]

  • homogeneously distributed in the cell membrane [Pubmed|23180473]
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([gene|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials


  • MGNA-B695 (yxcC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE39810 ([gene|0757FAEB38AA1C599C5067794AF83A4BA5912DC9|csbC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAATGTCTCCTCCTCAG, downstream forward: _UP4_TAAAAAAAGGAATCGTCTCC
  • BKK39810 ([gene|0757FAEB38AA1C599C5067794AF83A4BA5912DC9|csbC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAATGTCTCCTCCTCAG, downstream forward: _UP4_TAAAAAAAGGAATCGTCTCC
  • References

  • 10376822,21630458,15805528,23180473,22582280,24127585