SubtiBank SubtiBank
walH
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

walH

negative effector of [protein|E88978809272FAC2520DB4ABCA0554F8028F3451|WalK], controls cell wall metabolism
locus
BSU_40390
pI
5.59
mw
52.05 kDa
protein length
455 aa Sequence Blast
gene length
1368 bp Sequence Blast
function
control of cell wall metabolism
product
negative effector of [protein|E88978809272FAC2520DB4ABCA0554F8028F3451|WalK]
essential
no
synonyms
yycH

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.5|Cell wall/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.3|Control of response regulators/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    4,150,496 4,151,863

    Phenotypes of a mutant

  • growth defect at high temperature, lysis at 49C, this can be suppressed by mutations that reduce [protein|E88978809272FAC2520DB4ABCA0554F8028F3451|WalK] autokinase activity, by inactivation of [gene|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|lytE], or by overexpreesion of [protein|0CA55371306D4BD768CFA82027DCB4D581BCCB87|IseA] or [protein|603E226CE488A25C4E28A6A7363CCD65BE64BB21|PdaC] [pubmed|29465029]
  • The protein

    Structure

  • [PDB|2FGT]
  • [SW|Localization]

  • cell membrane (according to UniProt), spotty close to the membrane [Pubmed|21219466]
  • Expression and Regulation

    Operons

    genes
    [gene|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|walR]-[gene|E88978809272FAC2520DB4ABCA0554F8028F3451|walK]-[gene|06D2D03C65D50E3909B2C93835193815B6016967|walH]-[gene|EE681C9A42FCC29CBB55CC9566EE4CFF986D0F1D|walI]-[gene|D5321F707E183E72B225F1CED2F2FDCB1183B88A|walJ]-[gene|75B8C37E589C855D2BAD7FB51B9600E161ACFBD3|htrC]
    description
    [Pubmed|9829949]

    regulation

  • ''htrC'' transcript expressed during sporulation [Pubmed|9829949]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B826 (yycH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1825 NBRP B. subtilis, Japan]
  • BKE40390 ([gene|06D2D03C65D50E3909B2C93835193815B6016967|walH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGTAAGTAATATCGTTTTTA, downstream forward: _UP4_TTATTGAGGAAGGAGGGGGC
  • BKK40390 ([gene|06D2D03C65D50E3909B2C93835193815B6016967|walH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGTAAGTAATATCGTTTTTA, downstream forward: _UP4_TTATTGAGGAAGGAGGGGGC
  • References

    Reviews

  • 28886686
  • Original publications

  • 17307850,17350627,16600972,9829949,16030236,18408157,21219466,29465029