SubtiBank SubtiBank
fmt
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

fmt

methionyl-tRNA formyltransferase
locus
BSU15730
pI
5.62
mw
34.48 kDa
protein length
317 aa Sequence Blast
gene length
951 bp Sequence Blast
function
formylation of Met-tRNA(fMet)
product
methionyl-tRNA formyltransferase
essential
no
ec
2.1.2.9
synonyms
yloL

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.8|tRNA modification and maturation]
  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • Gene

    Coordinates
    1,646,999 → 1,647,952

    Phenotypes of a mutant

  • inactivation of ''[gene|06971E9AAB033E2878914A76645F99E97CE8A90A|fmt]'' suppresses the synthetic lethality of the ''[gene|3D41FB608DB70B9482312A1BBCCDBDA7FB713AFA|defA] [gene|53B760316B19E142FC3ECAD2CFAA540377B08BBC|defB]'' double mutant [Pubmed|27983482]
  • essential according to Kobayashi et al. [Pubmed|12682299], but a deletion mutant was constructed by Cai et al. [Pubmed|27983482]
  • the mutant is defective for [SW|biofilm formation], motility, and [SW|sporulation] [Pubmed|27983482]
  • the mutant exhibits increased sensitivity to metal ion excess and oxidative stress [Pubmed|27983482]
  • The protein

    Catalyzed reaction/ biological activity

  • 10-formyltetrahydrofolate + L-methionyl-tRNA(fMet) + H2O = tetrahydrofolate + N-formylmethionyl-tRNA(fMet) (according to Swiss-Prot)
  • Protein family

  • fmt family (according to Swiss-Prot)
  • Structure

  • [PDB|3RFO] (from ''Bacillus anthracis'', 69% identity, 89% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|3D41FB608DB70B9482312A1BBCCDBDA7FB713AFA|defA]-[gene|06971E9AAB033E2878914A76645F99E97CE8A90A|fmt]-[gene|1370D8783450D538C71E3DE8EA5B37DFEE073FF0|yloM]
    description
    [Pubmed|16964327]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16964327], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    additional information

  • [protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials

    Mutant

  • BKE15730 (Δ[gene|06971E9AAB033E2878914A76645F99E97CE8A90A|fmt]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAATACGATTCTCGTCA, downstream forward: _UP4_GCCGGTGATGTGTTAGGAGT
  • BKK15730 (Δ[gene|06971E9AAB033E2878914A76645F99E97CE8A90A|fmt]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAATACGATTCTCGTCA, downstream forward: _UP4_GCCGGTGATGTGTTAGGAGT
  • References

  • 8887566,19171795,27983482,12682299