SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


methionyl-tRNA formyltransferase
34.48 kDa
protein length
317 aa Sequence Blast
gene length
954 bp Sequence Blast
formylation of Met-tRNA(fMet)
methionyl-tRNA formyltransferase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|tRNA modification and maturation]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • Gene

    1,646,999 1,647,952

    Phenotypes of a mutant

  • inactivation of ''[gene|06971E9AAB033E2878914A76645F99E97CE8A90A|fmt]'' suppresses the synthetic lethality of the ''[gene|3D41FB608DB70B9482312A1BBCCDBDA7FB713AFA|defA] [gene|53B760316B19E142FC3ECAD2CFAA540377B08BBC|defB]'' double mutant [Pubmed|27983482]
  • essential according to Kobayashi et al. [Pubmed|12682299], but a deletion mutant was constructed by Cai et al. [Pubmed|27983482]
  • the mutant is defective for [SW|biofilm formation], motility, and [SW|sporulation] [Pubmed|27983482]
  • the mutant exhibits increased sensitivity to metal ion excess and oxidative stress [Pubmed|27983482]
  • The protein

    Catalyzed reaction/ biological activity

  • 10-formyltetrahydrofolate + L-methionyl-tRNA(fMet) + H2O = tetrahydrofolate + N-formylmethionyl-tRNA(fMet) (according to Swiss-Prot)
  • Protein family

  • fmt family (according to Swiss-Prot)
  • Structure

  • [PDB|3RFO] (from ''Bacillus anthracis'', 69% identity, 89% similarity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16964327], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab



  • [pubmed|22383849]
  • view in new tab

    additional information

  • [protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials


  • BKE15730 ([gene|06971E9AAB033E2878914A76645F99E97CE8A90A|fmt]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAATACGATTCTCGTCA, downstream forward: _UP4_GCCGGTGATGTGTTAGGAGT
  • BKK15730 ([gene|06971E9AAB033E2878914A76645F99E97CE8A90A|fmt]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAATACGATTCTCGTCA, downstream forward: _UP4_GCCGGTGATGTGTTAGGAGT
  • References

  • 8887566,19171795,27983482,12682299