SubtiBank SubtiBank
yxaJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yxaJ

unknown
locus
BSU_39950
pI
9.06
mw
14.85 kDa
protein length
142 aa Sequence Blast
gene length
426 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    4,103,762 → 4,104,187

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|0649520164CCC6120C40CE15EF08994BE0E79A25|yxaJ]-[gene|3BDC62A14BEEAEFD8E075E0958CAE41377808922|yxaL]
    description
    [Pubmed|10746760]

    regulatory mechanism

  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [Pubmed|15743949], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA]: repression, [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]-[protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA] [Pubmed|27902860,15743949], in [regulon|6740108089F13116F200C15F35C2E7561E990FEB|DnaA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675,18840696], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed by [protein|search|Rok] [Pubmed|15743949]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B765 (yxaJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1764 NBRP B. subtilis, Japan]
  • BKE39950 (Δ[gene|0649520164CCC6120C40CE15EF08994BE0E79A25|yxaJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAAACTCCTCCTTTAAT, downstream forward: _UP4_TAGTTTTCTAGTTTGTGATG
  • BKK39950 (Δ[gene|0649520164CCC6120C40CE15EF08994BE0E79A25|yxaJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAAACTCCTCCTTTAAT, downstream forward: _UP4_TAGTTTTCTAGTTTGTGATG
  • References

  • 10746760,15743949,220817675,27902860