SubtiBank SubtiBank
ypqE
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

ypqE

similar to PTS, EIIA component
locus
BSU22230
pI
5.29
mw
17.79 kDa
protein length
168 aa Sequence Blast
gene length
504 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW 1.2.2.2|Sugar specific PTS proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    Coordinates
    2,336,933 → 2,337,439

    The protein

    Protein family

  • [protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|PtsI] permease, glucose permease (Glc) family [Pubmed|10627040]
  • Expression and Regulation

    Operons

    genes
    [gene|06165870CB68E9C2F1546943CEA668C7790A9647|ypqE]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A477 (ypqE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/477 NBRP B. subtilis, Japan]
  • QB6099 (aphA3), available in [SW|Jörg Stülke]'s lab [Pubmed|10627040]
  • BKE22230 (''ypqE''::''ermC'') (available at the [http://www.bgsc.org/ BGSC] and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • GP1863 (''ypqE''::''ermC'') (available in [SW|Jörg Stülke]'s lab)
  • BKE22230 (Δ[gene|06165870CB68E9C2F1546943CEA668C7790A9647|ypqE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTATTTTCTCCCTTCT, downstream forward: _UP4_TAAGCAGGGCGTATGCCTTG
  • BKK22230 (Δ[gene|06165870CB68E9C2F1546943CEA668C7790A9647|ypqE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTATTTTCTCCCTTCT, downstream forward: _UP4_TAAGCAGGGCGTATGCCTTG
  • References

  • 10627040