SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


[category|SW 1.2.2|PTS] EIIA component
17.79 kDa
protein length
168 aa Sequence Blast
gene length
507 bp Sequence Blast
uptake and phosphorylation of maltose, N-acetylglucosamine, sucrose, and trehalose
[category|SW 1.2.2|PTS] EIIA component

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW|Sugar specific PTS proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    2,336,933 2,337,439

    The protein

    Protein family

  • [category|SW 1.2.2|PTS] permease, glucose family [Pubmed|10627040]
  • [SW|Domains]

  • [SW|PTS EIIA domain] type-1 (aa 36-140) (according to UniProt)
  • Structure

  • [PDB|1AX3] (IIA domain of [protein|B5E7EB475434E96786C577AE709A21BD702733D8|PtsG], 46% identity) [pubmed|9593197]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [pubmed|30038046], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials


  • MGNA-A477 (ypqE::erm), available at the [ NBRP B. subtilis, Japan]
  • QB6099 (aphA3), available in [SW|Jörg Stülke]'s lab [Pubmed|10627040]
  • BKE22230 (''ypqE''::''ermC'') (available at the [ BGSC] and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • GP1863 (''ypqE''::''ermC'') (available in [SW|Jörg Stülke]'s lab)
  • BKE22230 ([gene|06165870CB68E9C2F1546943CEA668C7790A9647|ptsA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTATTTTCTCCCTTCT, downstream forward: _UP4_TAAGCAGGGCGTATGCCTTG
  • BKK22230 ([gene|06165870CB68E9C2F1546943CEA668C7790A9647|ptsA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTATTTTCTCCCTTCT, downstream forward: _UP4_TAAGCAGGGCGTATGCCTTG
  • References

  • 10627040,30038046,9593197