SubtiBank SubtiBank
lipC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

lipC

spore coat protein, phospholipase implicated in spore germination
locus
BSU04110
pI
5.84
mw
23.46 kDa
protein length
213 aa Sequence Blast
gene length
642 bp Sequence Blast
function
spore germination
product
spore coat phospholipase B
essential
no
synonyms
ycsK

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW 2.4.1.1|Utilization of phospholipids]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.5|Class V]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.2|Additional germination proteins]
  • Gene

    Coordinates
    462,431 463,072

    Phenotypes of a mutant

  • defective in L-alanine-stimulated germination [Pubmed|20057119]
  • The protein

    Catalyzed reaction/ biological activity

  • cleaves the fatty acids at the sn-1 and sn-2 positions of phospholipids [Pubmed|20057119]
  • Protein family

  • [SW|'GDSL' lipolytic enzyme family] (according to UniProt)
  • [SW|Localization]

  • spore coat (basement), localization depends on [protein|A25C1530DA7BB007A288E525404E9F775E219FE8|SpoIVA] [Pubmed|22171814,17220230,20057119]
  • Expression and Regulation

    Operons

    genes
    [gene|05910B4500420D4DB75DAD3A7A2358C360FF2154|lipC]
    description
    (according to [http://dbtbs.hgc.jp/COG/prom/ycsFGI-kipIAR-ycsK.html DBTBS]) null

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,17220230], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|17220230], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed four hours after onset of [SW|sporulation ]([protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]) [Pubmed|17220230]
  • view in new tab

    genes
    [gene|77F758CE9A59AC41F283CB1F5099097386133799|pxpA]-[gene|9AD419E3CB86C54A0F11E96C82E80A357C6B23D2|ycsG]-[gene|312E2A4ADFBCB9DD9AD9EEEC9FE53F3932AF5DBA|ycsI]-[gene|5A5E17D39296FECC1C03B1A7791AB1065BB4E4DF|pxpB]-[gene|3BA8F1F71B1D65EB30867ABD27867F925DAD2D7B|pxpC]-[gene|7DA9A79876C546B78B716A64706A3A3716018C2E|kipR]-[gene|05910B4500420D4DB75DAD3A7A2358C360FF2154|lipC]
    description
    [Pubmed|9334321]

    regulatory mechanism

  • [protein|7DA9A79876C546B78B716A64706A3A3716018C2E|KipR]: repression, [Pubmed|9334321], in [regulon|7DA9A79876C546B78B716A64706A3A3716018C2E|KipR regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|9334321], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • induced in the presence of 5-oxoproline [pubmed|28830929]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C024 (ycsK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2022 NBRP B. subtilis, Japan]
  • BKE04110 ([gene|05910B4500420D4DB75DAD3A7A2358C360FF2154|lipC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTTTCCTCCACTCT, downstream forward: _UP4_TAGAAAACGCGCCTCATGAC
  • BKK04110 ([gene|05910B4500420D4DB75DAD3A7A2358C360FF2154|lipC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTTTCCTCCACTCT, downstream forward: _UP4_TAGAAAACGCGCCTCATGAC
  • References

    Reviews

  • 23202530,27227299
  • Original publications

  • 17220230,9334321,20057119,22171814,25755103