SubtiBank SubtiBank
lipC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

lipC

spore coat protein, phospholipase implicated in spore germination
locus
BSU_04110
pI
5.84
mw
23.46 kDa
protein length
213 aa Sequence Blast
gene length
642 bp Sequence Blast
function
spore germination
product
spore coat phospholipase B
essential
no
synonyms
ycsK

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW 2.4.1.1|Utilization of phospholipids]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.5|Class V]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.2|Additional germination proteins]
  • Gene

    Coordinates
    462,431 463,072

    Phenotypes of a mutant

  • defective in L-alanine-stimulated germination [Pubmed|20057119]
  • The protein

    Catalyzed reaction/ biological activity

  • cleaves the fatty acids at the sn-1 and sn-2 positions of phospholipids [Pubmed|20057119]
  • Protein family

  • [SW|'GDSL' lipolytic enzyme family] (according to UniProt)
  • [SW|Localization]

  • spore coat (basement), localization depends on [protein|A25C1530DA7BB007A288E525404E9F775E219FE8|SpoIVA] [Pubmed|22171814,17220230,20057119]
  • Expression and Regulation

    Operons

    genes
    [gene|05910B4500420D4DB75DAD3A7A2358C360FF2154|lipC]
    description
    (according to [http://dbtbs.hgc.jp/COG/prom/ycsFGI-kipIAR-ycsK.html DBTBS]) null

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,17220230], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|17220230], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed four hours after onset of [SW|sporulation ]([protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]) [Pubmed|17220230]
  • view in new tab

    genes
    [gene|77F758CE9A59AC41F283CB1F5099097386133799|pxpA]-[gene|9AD419E3CB86C54A0F11E96C82E80A357C6B23D2|ycsG]-[gene|312E2A4ADFBCB9DD9AD9EEEC9FE53F3932AF5DBA|ycsI]-[gene|5A5E17D39296FECC1C03B1A7791AB1065BB4E4DF|pxpB]-[gene|3BA8F1F71B1D65EB30867ABD27867F925DAD2D7B|pxpC]-[gene|7DA9A79876C546B78B716A64706A3A3716018C2E|kipR]-[gene|05910B4500420D4DB75DAD3A7A2358C360FF2154|lipC]
    description
    [Pubmed|9334321]

    regulatory mechanism

  • [protein|7DA9A79876C546B78B716A64706A3A3716018C2E|KipR]: repression, [Pubmed|9334321], in [regulon|7DA9A79876C546B78B716A64706A3A3716018C2E|KipR regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|9334321], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • induced in the presence of 5-oxoproline [pubmed|28830929]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C024 (ycsK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2022 NBRP B. subtilis, Japan]
  • BKE04110 ([gene|05910B4500420D4DB75DAD3A7A2358C360FF2154|lipC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTTTCCTCCACTCT, downstream forward: _UP4_TAGAAAACGCGCCTCATGAC
  • BKK04110 ([gene|05910B4500420D4DB75DAD3A7A2358C360FF2154|lipC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTTTCCTCCACTCT, downstream forward: _UP4_TAGAAAACGCGCCTCATGAC
  • References

    Reviews

  • 23202530,27227299
  • Original publications

  • 17220230,9334321,20057119,22171814,25755103