SubtiBank SubtiBank
ypiA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ypiA

unknown
locus
BSU_22590
pI
4.11
mw
48.16 kDa
protein length
423 aa Sequence Blast
gene length
1272 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,366,347 2,367,618

    The protein

    [SW|Domains]

  • nine [SW|TPR repeat|tetratrichopeptide repeats] (according to UniProt)
  • additional information

  • [protein|057BFF91609C918CEE4E6FF9100A1E4959BF6715|YpiA] may interact with [SW|RNA polymerase] [pubmed|21710567]
  • Expression and Regulation

    Operons

    genes
    [gene|057BFF91609C918CEE4E6FF9100A1E4959BF6715|ypiA]-[gene|CDBBCB467FE9442B3CE45CF9401C609295E1B99F|ypiB]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A406 (ypiA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/406 NBRP B. subtilis, Japan]
  • BKE22590 ([gene|057BFF91609C918CEE4E6FF9100A1E4959BF6715|ypiA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATCGGACCGGTCCTTTC, downstream forward: _UP4_TAAGCAGGAATATTAACCAT
  • BKK22590 ([gene|057BFF91609C918CEE4E6FF9100A1E4959BF6715|ypiA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATCGGACCGGTCCTTTC, downstream forward: _UP4_TAAGCAGGAATATTAACCAT
  • References

  • 21710567