SubtiBank SubtiBank
yczN
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yczN

putative toxin
locus
BSU_03789
pI
5.28
mw
3.70 kDa
protein length
gene length
114 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity]
  • Gene

    Coordinates
    430,356 430,469

    The protein

    Protein family

  • [SW|SscA family] (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|056F20E9D11BFB7A7EB15281902E8A8870BC6CFF|yczN]-[gene|2420C171CBDDC4EC695759EBD2D20CB151C3F73D|yczM]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|056F20E9D11BFB7A7EB15281902E8A8870BC6CFF|yczN]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE03789 ([gene|056F20E9D11BFB7A7EB15281902E8A8870BC6CFF|yczN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03789 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGGTTTCACCTCCCTA, downstream forward: _UP4_TAAGCTGCTGACCGTCTCTG
  • BKK03789 ([gene|056F20E9D11BFB7A7EB15281902E8A8870BC6CFF|yczN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03789 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGGTTTCACCTCCCTA, downstream forward: _UP4_TAAGCTGCTGACCGTCTCTG
  • References

  • 20156992